Mutagenetix > Incidental Mutation

Incidental Mutation 'R7154:Kalrn'

557178

Institutional Source

Beutler Lab

Gene Symbol

Kalrn

Ensembl Gene

ENSMUSG00000061751

Gene Name

kalirin, RhoGEF kinase

Synonyms

2210407G14Rik, Hapip, E530005C20Rik, LOC224126

MMRRC Submission

045256-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.922) question?

Stock #

R7154 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

33969073-34573532 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 34212157 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000110611 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000089655] [ENSMUST00000114947] [ENSMUST00000114949] [ENSMUST00000114953] [ENSMUST00000114954] [ENSMUST00000114960] [ENSMUST00000151491]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000076810

SMART Domains

Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751

Domain	Start	End	E-Value	Type
SEC14	20	159	2.22e-30	SMART
SPEC	173	289	5.32e-9	SMART
SPEC	295	397	1.19e-11	SMART
SPEC	400	515	1.83e0	SMART
SPEC	521	623	9.84e-13	SMART
SPEC	626	748	2.74e-2	SMART
SPEC	875	976	8.11e-14	SMART
SPEC	1106	1208	4.7e-10	SMART
RhoGEF	1258	1428	3.6e-56	SMART
PH	1442	1555	5.24e-8	SMART
SH3	1622	1683	1.23e-7	SMART
RhoGEF	1904	2074	1.47e-52	SMART
PH	2094	2199	9.87e-4	SMART
SH3	2295	2356	2.78e-2	SMART
IGc2	2455	2527	4.28e-12	SMART
FN3	2541	2623	3.07e-11	SMART
S_TKc	2656	2910	1.28e-71	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000089655

SMART Domains

Protein: ENSMUSP00000087084
Gene: ENSMUSG00000061751

Domain	Start	End	E-Value	Type
low complexity region	9	20	N/A	INTRINSIC
SEC14	38	177	2.22e-30	SMART
SPEC	191	307	5.32e-9	SMART
SPEC	313	415	1.19e-11	SMART
SPEC	418	533	1.83e0	SMART
SPEC	539	641	9.84e-13	SMART
SPEC	644	766	2.74e-2	SMART
SPEC	893	1003	1.85e-8	SMART
SPEC	1133	1235	4.7e-10	SMART
RhoGEF	1285	1455	3.6e-56	SMART
PH	1469	1582	5.24e-8	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000114947

SMART Domains

Protein: ENSMUSP00000110597
Gene: ENSMUSG00000061751

Domain	Start	End	E-Value	Type
SPEC	3	112	4.22e-3	SMART
internal_repeat_1	128	187	9.63e-6	PROSPERO
SPEC	239	349	1.85e-8	SMART
SPEC	479	581	4.7e-10	SMART
RhoGEF	631	801	3.6e-56	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000114949

SMART Domains

Protein: ENSMUSP00000110599
Gene: ENSMUSG00000061751

Domain	Start	End	E-Value	Type
SPEC	3	125	2.74e-2	SMART
internal_repeat_1	141	204	2.9e-5	PROSPERO
SPEC	252	353	8.11e-14	SMART
SPEC	483	585	4.7e-10	SMART
RhoGEF	635	805	3.6e-56	SMART
PH	819	932	5.24e-8	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000114953

SMART Domains

Protein: ENSMUSP00000110603
Gene: ENSMUSG00000061751

Domain	Start	End	E-Value	Type
SPEC	3	125	2.74e-2	SMART
internal_repeat_1	141	204	4.18e-5	PROSPERO
coiled coil region	217	248	N/A	INTRINSIC
SPEC	252	362	1.85e-8	SMART
SPEC	492	594	4.7e-10	SMART
RhoGEF	644	814	3.6e-56	SMART
PH	828	941	5.24e-8	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000114954

SMART Domains

Protein: ENSMUSP00000110604
Gene: ENSMUSG00000061751

Domain	Start	End	E-Value	Type
SPEC	3	125	2.74e-2	SMART
internal_repeat_1	141	204	4.18e-5	PROSPERO
coiled coil region	217	248	N/A	INTRINSIC
SPEC	252	362	1.85e-8	SMART
SPEC	492	594	4.7e-10	SMART
RhoGEF	644	814	3.6e-56	SMART
PH	828	941	5.24e-8	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000114960

SMART Domains

Protein: ENSMUSP00000110611
Gene: ENSMUSG00000061751

Domain	Start	End	E-Value	Type
low complexity region	9	20	N/A	INTRINSIC
SEC14	38	177	2.22e-30	SMART
SPEC	191	307	5.32e-9	SMART
SPEC	313	415	1.19e-11	SMART
SPEC	418	533	1.83e0	SMART
SPEC	539	641	9.84e-13	SMART
SPEC	644	766	2.74e-2	SMART
SPEC	893	994	8.11e-14	SMART
SPEC	1124	1226	4.7e-10	SMART
RhoGEF	1276	1446	3.6e-56	SMART
PH	1460	1573	5.24e-8	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000142817

SMART Domains

Protein: ENSMUSP00000116188
Gene: ENSMUSG00000061751

Domain	Start	End	E-Value	Type
SEC14	16	155	2.22e-30	SMART
SPEC	169	285	5.32e-9	SMART
SPEC	291	393	1.19e-11	SMART
SPEC	396	511	1.83e0	SMART
SPEC	517	619	9.84e-13	SMART
SPEC	622	744	2.74e-2	SMART
SPEC	871	972	8.11e-14	SMART
SPEC	1102	1204	4.7e-10	SMART
RhoGEF	1254	1424	3.6e-56	SMART
PH	1438	1551	5.24e-8	SMART
SH3	1618	1679	1.23e-7	SMART
RhoGEF	1900	2070	1.47e-52	SMART
PH	2090	2195	9.87e-4	SMART
SH3	2291	2352	2.78e-2	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000151491

SMART Domains

Protein: ENSMUSP00000123416
Gene: ENSMUSG00000061751

Domain	Start	End	E-Value	Type
SEC14	26	165	2.22e-30	SMART
SPEC	179	295	5.32e-9	SMART
SPEC	301	403	1.19e-11	SMART
SPEC	640	750	1.85e-8	SMART
SPEC	880	982	4.7e-10	SMART
RhoGEF	1032	1202	3.6e-56	SMART
PH	1216	1329	5.24e-8	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030423J24Rik	T	C	13: 70,884,225 (GRCm38)	F139L	unknown	Het
Adgre1	G	A	17: 57,444,087 (GRCm38)		probably null	Het
Agap2	A	G	10: 127,091,655 (GRCm38)	D1135G	probably benign	Het
Akp3	T	C	1: 87,125,224 (GRCm38)	L45P	probably damaging	Het
Arfgap3	A	T	15: 83,336,704 (GRCm38)	W71R	probably damaging	Het
Asic3	G	A	5: 24,413,662 (GRCm38)		probably benign	Het
Asph	A	T	4: 9,630,930 (GRCm38)	N139K	possibly damaging	Het
Atr	T	A	9: 95,865,045 (GRCm38)	C127S	probably benign	Het
Auts2	A	T	5: 131,451,893 (GRCm38)	S255T		Het
Bcl6	G	A	16: 23,966,226 (GRCm38)	R675*	probably null	Het
Cacnb1	A	G	11: 98,005,133 (GRCm38)	L443P	probably damaging	Het
Cbfa2t3	G	A	8: 122,638,144 (GRCm38)	Q300*	probably null	Het
Ccer1	A	T	10: 97,694,339 (GRCm38)	D288V	unknown	Het
Col18a1	G	A	10: 77,072,965 (GRCm38)	P611S	probably benign	Het
Cpa6	T	A	1: 10,337,469 (GRCm38)	D281V	possibly damaging	Het
Cyp2e1	A	G	7: 140,770,137 (GRCm38)	Y245C	probably damaging	Het
Cyp4a31	T	C	4: 115,574,766 (GRCm38)		probably null	Het
Entpd1	T	C	19: 40,724,986 (GRCm38)	Y188H	probably damaging	Het
Epb42	T	C	2: 121,033,362 (GRCm38)	D111G	probably benign	Het
Espl1	A	G	15: 102,324,049 (GRCm38)	D2064G	probably damaging	Het
Fat3	A	C	9: 15,996,864 (GRCm38)	V2614G	probably damaging	Het
Fos	A	T	12: 85,474,157 (GRCm38)	M40L	probably benign	Het
Frmd4b	T	A	6: 97,306,746 (GRCm38)	E434V	probably damaging	Het
Galnt6	A	T	15: 100,693,464 (GRCm38)	D586E	probably benign	Het
Gapvd1	T	C	2: 34,725,063 (GRCm38)	K474R	probably damaging	Het
Gimap8	T	A	6: 48,656,188 (GRCm38)	F314I	probably damaging	Het
Gm10696	A	G	3: 94,176,219 (GRCm38)	I95T	probably benign	Het
Gm11639	T	A	11: 104,699,140 (GRCm38)		probably null	Het
Gm14393	T	G	2: 175,061,783 (GRCm38)	K110N	probably damaging	Het
Gm4131	C	A	14: 62,480,933 (GRCm38)	A75S	probably damaging	Het
Heatr6	G	A	11: 83,777,241 (GRCm38)	V854I	probably benign	Het
Hic2	T	A	16: 17,258,942 (GRCm38)	M545K	possibly damaging	Het
Ip6k1	A	G	9: 108,045,662 (GRCm38)	Y331C	probably damaging	Het
Kxd1	T	C	8: 70,515,434 (GRCm38)	K88E	probably damaging	Het
Lrrc37a	A	C	11: 103,502,856 (GRCm38)	V581G	probably benign	Het
Mex3d	A	T	10: 80,386,750 (GRCm38)	V224E		Het
Mtx2	T	A	2: 74,876,418 (GRCm38)	C246S	probably damaging	Het
Mybbp1a	A	G	11: 72,447,642 (GRCm38)		probably null	Het
Myh6	A	G	14: 54,960,307 (GRCm38)	I458T	probably benign	Het
Ndufs6	A	G	13: 73,320,292 (GRCm38)	V96A	possibly damaging	Het
Nemf	A	T	12: 69,316,741 (GRCm38)		probably null	Het
Notch1	T	C	2: 26,459,938 (GRCm38)	S2397G	probably benign	Het
Olfr1229	A	G	2: 89,282,860 (GRCm38)	I91T	probably damaging	Het
Olfr522	T	C	7: 140,162,084 (GRCm38)	I289V	probably benign	Het
Osbpl1a	T	C	18: 12,768,592 (GRCm38)	E619G	probably benign	Het
Pfkl	T	C	10: 78,001,455 (GRCm38)	R95G	probably benign	Het
Plat	T	A	8: 22,778,505 (GRCm38)	I391K	possibly damaging	Het
Ppp1r21	A	G	17: 88,554,886 (GRCm38)	H244R	probably damaging	Het
Rapgef3	G	C	15: 97,753,877 (GRCm38)	H578Q	probably benign	Het
Rnf145	C	A	11: 44,524,995 (GRCm38)	N12K	probably damaging	Het
Sfxn5	C	T	6: 85,332,423 (GRCm38)	C100Y	unknown	Het
Sh3rf1	T	A	8: 61,372,714 (GRCm38)	L581Q	possibly damaging	Het
Sipa1l2	T	C	8: 125,468,339 (GRCm38)	K887E	probably benign	Het
Stard9	A	C	2: 120,704,542 (GRCm38)	Q3760P	probably benign	Het
Stard9	C	A	2: 120,701,314 (GRCm38)	T2684N	probably benign	Het
Stpg2	A	G	3: 139,215,295 (GRCm38)	E87G	probably benign	Het
Syne2	A	G	12: 76,059,457 (GRCm38)	Q792R	possibly damaging	Het
Taf7	T	C	18: 37,642,548 (GRCm38)	D322G	possibly damaging	Het
Tbc1d1	A	G	5: 64,173,813 (GRCm38)	S112G	possibly damaging	Het
Tbx3	A	G	5: 119,672,028 (GRCm38)	M5V	possibly damaging	Het
Tmem45b	A	T	9: 31,428,032 (GRCm38)	I215N	possibly damaging	Het
Tpd52	G	A	3: 8,963,856 (GRCm38)	Q43*	probably null	Het
Trpa1	T	A	1: 14,882,233 (GRCm38)	N858I	possibly damaging	Het
Ttc30b	C	T	2: 75,938,061 (GRCm38)	R116H	possibly damaging	Het
Ttll5	A	G	12: 85,925,764 (GRCm38)	D767G	probably damaging	Het
Vmn2r3	G	A	3: 64,287,311 (GRCm38)	T62I	probably benign	Het
Wdr59	A	T	8: 111,458,735 (GRCm38)	N874K		Het

Other mutations in Kalrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01361:Kalrn	APN	16	34,175,722 (GRCm38)	splice site	probably benign
IGL01364:Kalrn	APN	16	34,262,629 (GRCm38)	missense	probably damaging	1.00
IGL01510:Kalrn	APN	16	34,235,330 (GRCm38)	missense	possibly damaging	0.52
IGL01664:Kalrn	APN	16	34,294,161 (GRCm38)	missense	probably damaging	1.00
IGL01934:Kalrn	APN	16	34,198,512 (GRCm38)	splice site	probably null
IGL02059:Kalrn	APN	16	34,252,341 (GRCm38)	missense	possibly damaging	0.95
IGL02102:Kalrn	APN	16	34,220,222 (GRCm38)	missense	probably damaging	1.00
IGL02306:Kalrn	APN	16	34,310,527 (GRCm38)	missense	probably damaging	0.97
IGL02328:Kalrn	APN	16	34,332,224 (GRCm38)	missense	probably damaging	0.98
IGL02532:Kalrn	APN	16	34,360,846 (GRCm38)	missense	probably damaging	1.00
IGL02685:Kalrn	APN	16	34,513,959 (GRCm38)	nonsense	probably null
IGL02696:Kalrn	APN	16	34,220,114 (GRCm38)	missense	probably damaging	1.00
IGL02708:Kalrn	APN	16	34,392,050 (GRCm38)	missense	probably damaging	1.00
IGL02937:Kalrn	APN	16	34,220,130 (GRCm38)	nonsense	probably null
IGL03188:Kalrn	APN	16	34,314,192 (GRCm38)	missense	probably benign	0.01
IGL03289:Kalrn	APN	16	34,385,297 (GRCm38)	missense	possibly damaging	0.90
IGL03408:Kalrn	APN	16	34,314,176 (GRCm38)	missense	probably damaging	0.99
breeze	UTSW	16	34,013,675 (GRCm38)	missense
ethereal	UTSW	16	33,975,435 (GRCm38)	utr 3 prime	probably benign
Feather	UTSW	16	34,314,209 (GRCm38)	missense	probably damaging	0.99
Hidden	UTSW	16	34,027,976 (GRCm38)	missense	probably damaging	1.00
Soulful	UTSW	16	34,187,484 (GRCm38)	nonsense	probably null
G1Funyon:Kalrn	UTSW	16	34,357,100 (GRCm38)	missense	probably benign	0.05
PIT4498001:Kalrn	UTSW	16	34,031,582 (GRCm38)	missense	possibly damaging	0.81
R0019:Kalrn	UTSW	16	34,198,514 (GRCm38)	splice site	probably benign
R0043:Kalrn	UTSW	16	34,054,906 (GRCm38)	missense	probably damaging	1.00
R0052:Kalrn	UTSW	16	34,357,171 (GRCm38)	missense	probably damaging	1.00
R0066:Kalrn	UTSW	16	34,203,957 (GRCm38)	missense	probably damaging	1.00
R0098:Kalrn	UTSW	16	33,975,619 (GRCm38)	missense	possibly damaging	0.89
R0098:Kalrn	UTSW	16	33,975,619 (GRCm38)	missense	possibly damaging	0.89
R0111:Kalrn	UTSW	16	34,031,590 (GRCm38)	missense	probably damaging	1.00
R0113:Kalrn	UTSW	16	34,049,936 (GRCm38)	intron	probably benign
R0183:Kalrn	UTSW	16	34,171,379 (GRCm38)	splice site	probably null
R0422:Kalrn	UTSW	16	34,314,273 (GRCm38)	missense	probably damaging	0.99
R0498:Kalrn	UTSW	16	34,054,891 (GRCm38)	missense	possibly damaging	0.61
R0614:Kalrn	UTSW	16	33,993,670 (GRCm38)	splice site	probably benign
R0656:Kalrn	UTSW	16	34,032,467 (GRCm38)	missense	probably damaging	1.00
R0671:Kalrn	UTSW	16	34,116,408 (GRCm38)	missense	probably benign	0.04
R0707:Kalrn	UTSW	16	34,010,581 (GRCm38)	missense	possibly damaging	0.88
R0709:Kalrn	UTSW	16	34,035,554 (GRCm38)	missense	probably damaging	1.00
R0834:Kalrn	UTSW	16	34,049,919 (GRCm38)	missense	possibly damaging	0.94
R0976:Kalrn	UTSW	16	34,385,390 (GRCm38)	missense	probably damaging	1.00
R1297:Kalrn	UTSW	16	34,016,498 (GRCm38)	missense	probably damaging	0.99
R1355:Kalrn	UTSW	16	33,975,584 (GRCm38)	missense	possibly damaging	0.74
R1370:Kalrn	UTSW	16	33,975,584 (GRCm38)	missense	possibly damaging	0.74
R1389:Kalrn	UTSW	16	33,988,803 (GRCm38)	missense	probably benign	0.01
R1398:Kalrn	UTSW	16	34,212,820 (GRCm38)	missense	probably damaging	1.00
R1427:Kalrn	UTSW	16	33,975,754 (GRCm38)	missense	probably damaging	1.00
R1458:Kalrn	UTSW	16	34,174,487 (GRCm38)	missense	probably damaging	1.00
R1470:Kalrn	UTSW	16	34,187,471 (GRCm38)	missense	probably damaging	1.00
R1470:Kalrn	UTSW	16	34,187,471 (GRCm38)	missense	probably damaging	1.00
R1557:Kalrn	UTSW	16	34,314,278 (GRCm38)	missense	possibly damaging	0.92
R1559:Kalrn	UTSW	16	34,010,548 (GRCm38)	missense	possibly damaging	0.92
R1654:Kalrn	UTSW	16	33,975,738 (GRCm38)	missense	probably damaging	1.00
R1703:Kalrn	UTSW	16	34,205,326 (GRCm38)	missense	probably damaging	1.00
R1759:Kalrn	UTSW	16	34,360,950 (GRCm38)	missense	probably damaging	0.97
R1764:Kalrn	UTSW	16	34,212,873 (GRCm38)	missense	probably damaging	1.00
R1824:Kalrn	UTSW	16	34,294,215 (GRCm38)	missense	probably damaging	1.00
R1845:Kalrn	UTSW	16	34,356,961 (GRCm38)	missense	probably damaging	0.99
R1850:Kalrn	UTSW	16	33,975,923 (GRCm38)	missense	probably damaging	0.98
R1921:Kalrn	UTSW	16	34,392,093 (GRCm38)	missense	probably benign	0.02
R1922:Kalrn	UTSW	16	34,392,093 (GRCm38)	missense	probably benign	0.02
R1970:Kalrn	UTSW	16	33,977,524 (GRCm38)	critical splice donor site	probably null
R1991:Kalrn	UTSW	16	33,975,738 (GRCm38)	missense	probably damaging	1.00
R1992:Kalrn	UTSW	16	33,975,738 (GRCm38)	missense	probably damaging	1.00
R2001:Kalrn	UTSW	16	34,028,045 (GRCm38)	missense	probably damaging	1.00
R2025:Kalrn	UTSW	16	34,189,736 (GRCm38)	missense	probably damaging	0.96
R2048:Kalrn	UTSW	16	34,252,310 (GRCm38)	missense	probably benign	0.18
R2076:Kalrn	UTSW	16	34,332,143 (GRCm38)	missense	probably benign	0.15
R2118:Kalrn	UTSW	16	34,332,230 (GRCm38)	missense	possibly damaging	0.84
R2136:Kalrn	UTSW	16	34,307,724 (GRCm38)	missense	possibly damaging	0.82
R2145:Kalrn	UTSW	16	34,009,262 (GRCm38)	unclassified	probably benign
R2193:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2195:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2234:Kalrn	UTSW	16	34,176,262 (GRCm38)	splice site	probably null
R2404:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2405:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2408:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2411:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2570:Kalrn	UTSW	16	34,310,495 (GRCm38)	missense	probably damaging	1.00
R2903:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2904:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2924:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R3411:Kalrn	UTSW	16	34,212,272 (GRCm38)	missense	probably benign	0.07
R3693:Kalrn	UTSW	16	34,357,315 (GRCm38)	missense	probably damaging	1.00
R3709:Kalrn	UTSW	16	34,392,030 (GRCm38)	splice site	probably null
R3788:Kalrn	UTSW	16	34,220,240 (GRCm38)	missense	probably damaging	1.00
R3833:Kalrn	UTSW	16	34,039,889 (GRCm38)	nonsense	probably null
R3871:Kalrn	UTSW	16	34,203,856 (GRCm38)	splice site	probably null
R3934:Kalrn	UTSW	16	34,310,531 (GRCm38)	missense	probably benign	0.34
R4033:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4056:Kalrn	UTSW	16	34,314,209 (GRCm38)	missense	probably damaging	0.99
R4057:Kalrn	UTSW	16	34,314,209 (GRCm38)	missense	probably damaging	0.99
R4303:Kalrn	UTSW	16	34,235,391 (GRCm38)	missense	probably damaging	1.00
R4402:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4444:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4482:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4487:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4558:Kalrn	UTSW	16	33,987,208 (GRCm38)	missense	possibly damaging	0.46
R4572:Kalrn	UTSW	16	34,392,042 (GRCm38)	missense	probably damaging	0.98
R4583:Kalrn	UTSW	16	34,235,267 (GRCm38)	missense	probably damaging	1.00
R4604:Kalrn	UTSW	16	34,513,926 (GRCm38)	missense	possibly damaging	0.46
R4620:Kalrn	UTSW	16	34,028,705 (GRCm38)	missense	probably damaging	0.99
R4651:Kalrn	UTSW	16	34,176,391 (GRCm38)	missense	probably damaging	1.00
R4703:Kalrn	UTSW	16	34,203,957 (GRCm38)	missense	probably damaging	1.00
R4704:Kalrn	UTSW	16	34,203,957 (GRCm38)	missense	probably damaging	1.00
R4705:Kalrn	UTSW	16	34,203,957 (GRCm38)	missense	probably damaging	1.00
R4760:Kalrn	UTSW	16	34,198,487 (GRCm38)	missense	probably damaging	1.00
R4793:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4794:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4811:Kalrn	UTSW	16	34,356,969 (GRCm38)	missense	probably damaging	1.00
R4816:Kalrn	UTSW	16	34,514,019 (GRCm38)	unclassified	probably benign
R4888:Kalrn	UTSW	16	34,171,330 (GRCm38)	missense	probably damaging	1.00
R4952:Kalrn	UTSW	16	34,357,415 (GRCm38)	splice site	probably null
R5030:Kalrn	UTSW	16	33,975,742 (GRCm38)	missense	probably benign	0.00
R5045:Kalrn	UTSW	16	34,314,352 (GRCm38)	nonsense	probably null
R5117:Kalrn	UTSW	16	34,033,601 (GRCm38)	critical splice acceptor site	probably null
R5289:Kalrn	UTSW	16	34,252,341 (GRCm38)	missense	possibly damaging	0.95
R5426:Kalrn	UTSW	16	34,262,653 (GRCm38)	missense	probably damaging	1.00
R5432:Kalrn	UTSW	16	34,053,622 (GRCm38)	missense	probably damaging	1.00
R5611:Kalrn	UTSW	16	34,175,780 (GRCm38)	missense	probably damaging	1.00
R5629:Kalrn	UTSW	16	34,039,934 (GRCm38)	missense	possibly damaging	0.77
R5635:Kalrn	UTSW	16	34,014,084 (GRCm38)	missense	probably damaging	1.00
R5713:Kalrn	UTSW	16	34,016,579 (GRCm38)	missense	probably benign
R5716:Kalrn	UTSW	16	33,987,176 (GRCm38)	missense	probably benign	0.01
R5772:Kalrn	UTSW	16	33,975,820 (GRCm38)	missense	probably damaging	1.00
R5797:Kalrn	UTSW	16	34,212,249 (GRCm38)	missense	probably damaging	0.98
R5835:Kalrn	UTSW	16	33,987,091 (GRCm38)	missense	probably benign	0.28
R5895:Kalrn	UTSW	16	33,975,435 (GRCm38)	utr 3 prime	probably benign
R5924:Kalrn	UTSW	16	34,243,833 (GRCm38)	missense	probably damaging	1.00
R5999:Kalrn	UTSW	16	34,357,343 (GRCm38)	missense	probably damaging	1.00
R6010:Kalrn	UTSW	16	34,010,580 (GRCm38)	missense	probably benign	0.06
R6052:Kalrn	UTSW	16	34,360,885 (GRCm38)	missense	probably damaging	1.00
R6122:Kalrn	UTSW	16	33,985,191 (GRCm38)	missense	possibly damaging	0.82
R6128:Kalrn	UTSW	16	34,212,885 (GRCm38)	missense	probably damaging	0.99
R6136:Kalrn	UTSW	16	34,357,111 (GRCm38)	missense	probably damaging	1.00
R6178:Kalrn	UTSW	16	34,053,639 (GRCm38)	missense	possibly damaging	0.88
R6229:Kalrn	UTSW	16	34,055,071 (GRCm38)	missense	probably damaging	1.00
R6376:Kalrn	UTSW	16	33,975,991 (GRCm38)	missense	probably benign
R6397:Kalrn	UTSW	16	33,992,985 (GRCm38)	missense	probably damaging	1.00
R6429:Kalrn	UTSW	16	34,332,164 (GRCm38)	missense	possibly damaging	0.85
R6473:Kalrn	UTSW	16	34,205,302 (GRCm38)	missense	probably damaging	1.00
R6481:Kalrn	UTSW	16	34,360,984 (GRCm38)	missense	probably damaging	1.00
R6597:Kalrn	UTSW	16	34,182,747 (GRCm38)	missense	probably damaging	1.00
R6736:Kalrn	UTSW	16	34,217,923 (GRCm38)	missense	probably damaging	1.00
R6808:Kalrn	UTSW	16	34,027,976 (GRCm38)	missense	probably damaging	1.00
R6897:Kalrn	UTSW	16	33,975,703 (GRCm38)	missense	probably damaging	0.99
R6955:Kalrn	UTSW	16	34,220,136 (GRCm38)	missense	probably damaging	1.00
R7060:Kalrn	UTSW	16	34,357,048 (GRCm38)	missense	probably damaging	0.99
R7064:Kalrn	UTSW	16	34,217,891 (GRCm38)	missense	probably damaging	1.00
R7132:Kalrn	UTSW	16	34,256,227 (GRCm38)	missense	unknown
R7181:Kalrn	UTSW	16	34,163,077 (GRCm38)	missense	probably benign	0.00
R7234:Kalrn	UTSW	16	34,176,422 (GRCm38)	missense	possibly damaging	0.63
R7235:Kalrn	UTSW	16	34,175,761 (GRCm38)	missense	probably benign	0.18
R7504:Kalrn	UTSW	16	34,256,233 (GRCm38)	missense	unknown
R7563:Kalrn	UTSW	16	34,392,094 (GRCm38)	missense	probably damaging	0.97
R7612:Kalrn	UTSW	16	34,314,212 (GRCm38)	missense	possibly damaging	0.68
R7772:Kalrn	UTSW	16	34,031,582 (GRCm38)	missense	probably benign	0.04
R7796:Kalrn	UTSW	16	34,187,484 (GRCm38)	nonsense	probably null
R7867:Kalrn	UTSW	16	33,989,791 (GRCm38)	missense	possibly damaging	0.94
R7869:Kalrn	UTSW	16	33,988,847 (GRCm38)	missense	probably damaging	0.98
R7914:Kalrn	UTSW	16	34,028,752 (GRCm38)	missense	probably benign
R8080:Kalrn	UTSW	16	33,975,668 (GRCm38)	missense	possibly damaging	0.83
R8147:Kalrn	UTSW	16	34,055,044 (GRCm38)	missense	probably benign
R8239:Kalrn	UTSW	16	34,049,783 (GRCm38)	missense	noncoding transcript
R8281:Kalrn	UTSW	16	34,035,061 (GRCm38)	nonsense	probably null
R8294:Kalrn	UTSW	16	34,033,584 (GRCm38)	missense	probably benign	0.12
R8301:Kalrn	UTSW	16	34,357,100 (GRCm38)	missense	probably benign	0.05
R8686:Kalrn	UTSW	16	34,360,935 (GRCm38)	missense	probably damaging	1.00
R8693:Kalrn	UTSW	16	34,034,514 (GRCm38)	missense	probably damaging	1.00
R8798:Kalrn	UTSW	16	33,982,855 (GRCm38)	missense	possibly damaging	0.65
R8878:Kalrn	UTSW	16	34,205,326 (GRCm38)	missense	probably damaging	1.00
R8878:Kalrn	UTSW	16	34,198,460 (GRCm38)	missense	probably benign	0.05
R8880:Kalrn	UTSW	16	34,217,935 (GRCm38)	missense	probably damaging	1.00
R8883:Kalrn	UTSW	16	33,993,655 (GRCm38)	missense	probably damaging	1.00
R8887:Kalrn	UTSW	16	34,227,126 (GRCm38)	missense	probably benign	0.22
R9048:Kalrn	UTSW	16	34,034,484 (GRCm38)	missense	possibly damaging	0.84
R9111:Kalrn	UTSW	16	34,361,001 (GRCm38)	missense	probably damaging	0.96
R9317:Kalrn	UTSW	16	34,013,675 (GRCm38)	missense
R9424:Kalrn	UTSW	16	33,988,818 (GRCm38)	missense	probably benign	0.06
R9442:Kalrn	UTSW	16	34,095,879 (GRCm38)	start codon destroyed	probably null	0.56
R9445:Kalrn	UTSW	16	33,985,230 (GRCm38)	missense	probably benign	0.13
R9515:Kalrn	UTSW	16	34,034,494 (GRCm38)	missense	probably damaging	1.00
R9516:Kalrn	UTSW	16	34,034,494 (GRCm38)	missense	probably damaging	1.00
R9625:Kalrn	UTSW	16	34,028,827 (GRCm38)	critical splice acceptor site	probably null
R9645:Kalrn	UTSW	16	34,212,213 (GRCm38)	missense	probably benign	0.01
RF014:Kalrn	UTSW	16	34,039,933 (GRCm38)	missense	probably benign	0.01
Z1177:Kalrn	UTSW	16	34,035,506 (GRCm38)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACGGATGCCCTGTTTGGAG -3'
(R):5'- CACATTTCCTGGGTCCCAAC -3'

Sequencing Primer
(F):5'- TTTGGAGATGTAATTTGGGAAGAAC -3'
(R):5'- TGGCATGTTTCCCCACTGAGAG -3'

Posted On

2019-06-26