Mutagenetix > Incidental Mutation

Incidental Mutation 'R7155:Plcg1'

557194

Institutional Source

Beutler Lab

Gene Symbol

Plcg1

Ensembl Gene

ENSMUSG00000016933

Gene Name

phospholipase C, gamma 1

Synonyms

Cded, Plc-gamma1, Plcg-1, Plc-1

MMRRC Submission

045226-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7155 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

160731300-160775760 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 160754380 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 632 (L632P)

Ref Sequence

ENSEMBL: ENSMUSP00000099404 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103115] [ENSMUST00000109462] [ENSMUST00000151590]

AlphaFold

Q62077

Predicted Effect

probably damaging
Transcript: ENSMUST00000103115
AA Change: L632P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099404
Gene: ENSMUSG00000016933
AA Change: L632P

Domain	Start	End	E-Value	Type
PH	33	144	5.54e-7	SMART
PLCXc	320	464	3.7e-91	SMART
PH	489	680	2.99e1	SMART
SH2	548	645	1.12e-30	SMART
SH2	666	747	3.78e-28	SMART
SH3	794	850	6.49e-16	SMART
PH	804	933	8.93e-2	SMART
PLCYc	953	1070	3.23e-73	SMART
C2	1089	1192	1.37e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109462
AA Change: L632P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105088
Gene: ENSMUSG00000016933
AA Change: L632P

Domain	Start	End	E-Value	Type
PH	33	144	5.54e-7	SMART
Pfam:EF-hand_like	240	318	5.2e-8	PFAM
PLCXc	320	464	3.7e-91	SMART
PH	489	680	2.99e1	SMART
SH2	548	645	1.12e-30	SMART
SH2	666	747	3.78e-28	SMART
SH3	794	850	6.49e-16	SMART
PH	804	933	8.93e-2	SMART
PLCYc	953	1070	3.23e-73	SMART
C2	1089	1192	1.37e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000151590

SMART Domains

Protein: ENSMUSP00000133771
Gene: ENSMUSG00000016933

Domain	Start	End	E-Value	Type
PH	33	144	5.54e-7	SMART
Pfam:EF-hand_like	239	318	4.4e-8	PFAM
PLCXc	320	464	3.7e-91	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of receptor-mediated tyrosine kinase activators. For example, when activated by SRC, the encoded protein causes the Ras guanine nucleotide exchange factor RasGRP1 to translocate to the Golgi, where it activates Ras. Also, this protein has been shown to be a major substrate for heparin-binding growth factor 1 (acidic fibroblast growth factor)-activated tyrosine kinase. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality associated with arrested growth and/or abnormal hematopoiesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	A	G	2: 151,473,569	L63P	possibly damaging	Het
Abca13	A	T	11: 9,529,010	Y4286F	probably benign	Het
Aldh5a1	A	C	13: 24,911,589	V515G	possibly damaging	Het
Ankrd42	T	C	7: 92,591,933	E406G	possibly damaging	Het
Arfgef2	T	A	2: 166,865,813	M1043K	probably benign	Het
Arhgef11	T	A	3: 87,709,572	Y383*	probably null	Het
Aste1	C	T	9: 105,405,136	P614L	probably damaging	Het
B3galt5	T	A	16: 96,315,805	S213T	probably damaging	Het
Bak1	A	G	17: 27,022,460	L108P	possibly damaging	Het
Bcl6	G	A	16: 23,966,226	R675*	probably null	Het
Bdp1	T	G	13: 100,061,151	T909P	possibly damaging	Het
Cacna1i	A	G	15: 80,395,238	H2060R	probably benign	Het
Cdhr3	G	T	12: 33,061,773	P246Q	probably damaging	Het
Colgalt1	T	C	8: 71,623,710	S602P	probably damaging	Het
Csde1	T	C	3: 103,039,953	S74P	probably damaging	Het
Cyp51	A	T	5: 4,087,846	C366S	possibly damaging	Het
Dcaf7	A	G	11: 106,037,190	N23D	probably damaging	Het
Ddx10	G	A	9: 53,117,288	A772V	probably benign	Het
Ddx4	A	G	13: 112,613,785	F404S	probably benign	Het
Dirc2	G	T	16: 35,735,577	T171K	probably benign	Het
Dlg4	T	A	11: 70,017,216	M1K	probably null	Het
Dnajc6	T	C	4: 101,612,945	V293A	probably damaging	Het
Etl4	G	T	2: 20,806,931	R1643L	probably damaging	Het
F13b	G	A	1: 139,508,157	E234K	probably damaging	Het
Fam171a1	T	C	2: 3,225,729	I633T	probably benign	Het
Frem3	A	G	8: 80,616,039	I1654V	probably benign	Het
Galr2	A	G	11: 116,283,582	E346G	possibly damaging	Het
Gck	G	A	11: 5,949,705		probably benign	Het
Gen1	G	T	12: 11,241,832	T717K	probably benign	Het
Gm13083	A	T	4: 143,616,165	I281F	probably benign	Het
Gpatch8	TTCCTCCTCCTCCTCTTCCTCCTCCTC	TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC	11: 102,480,188		probably benign	Het
Hat1	A	G	2: 71,421,251	T215A	possibly damaging	Het
Hmbox1	A	T	14: 64,897,037	M38K	probably damaging	Het
Ifi47	A	G	11: 49,096,542	K379E	probably benign	Het
Ift81	T	C	5: 122,568,999	Y460C	probably damaging	Het
Jarid2	T	A	13: 44,902,462	S381R	probably damaging	Het
Kmt2b	A	T	7: 30,579,963	V1458E	probably damaging	Het
Kpna4	G	T	3: 69,089,933	P336Q	probably damaging	Het
Krt84	T	C	15: 101,532,254	R168G	probably damaging	Het
Lhx8	T	A	3: 154,324,584	Y137F	possibly damaging	Het
Lin7b	T	C	7: 45,370,227	E19G	probably damaging	Het
Lrmda	A	T	14: 22,584,540	R131S	probably damaging	Het
Lrrc75b	C	T	10: 75,553,678	A280T	possibly damaging	Het
Megf11	G	A	9: 64,647,951	R268K	probably null	Het
Mgat4e	G	T	1: 134,541,959	Q116K	probably damaging	Het
Mlkl	A	G	8: 111,319,403	L325P	probably damaging	Het
Mup2	A	G	4: 60,137,641	L134P	probably damaging	Het
Myo19	A	G	11: 84,900,586	E489G	probably damaging	Het
Ncbp3	C	A	11: 73,048,009	P37Q	probably damaging	Het
Nf2	A	G	11: 4,799,964	V236A	probably damaging	Het
Nlrp1a	A	T	11: 71,124,079	M115K	possibly damaging	Het
Nsf	T	A	11: 103,828,530	K649*	probably null	Het
Olfml2b	A	T	1: 170,666,785	I313L	probably benign	Het
Olfr316	T	A	11: 58,758,283	I206N	probably damaging	Het
Olfr654	T	A	7: 104,588,557	V251D	possibly damaging	Het
Papln	T	A	12: 83,776,521	L444Q	probably damaging	Het
Phc3	T	C	3: 30,914,197	I897V	probably benign	Het
Prkg1	T	C	19: 31,302,301	T178A	probably damaging	Het
Ptges	T	A	2: 30,892,804	T79S	probably benign	Het
Rab26	T	C	17: 24,532,289	T81A	probably damaging	Het
Rai14	T	A	15: 10,595,003	I145L	possibly damaging	Het
Rasgrf1	A	G	9: 90,002,361	T960A	possibly damaging	Het
Rfx1	A	T	8: 84,094,826	I755F	probably damaging	Het
Rims1	T	G	1: 22,432,923	L670F	probably damaging	Het
Rtkn	G	A	6: 83,149,711	C297Y	probably damaging	Het
Sec23a	A	T	12: 58,989,443	N378K	probably benign	Het
Slc17a2	A	G	13: 23,822,407	E472G	probably benign	Het
Slc1a2	T	C	2: 102,766,995	M449T	probably damaging	Het
Slc22a3	G	A	17: 12,433,631	L369F	possibly damaging	Het
Smad6	G	T	9: 64,021,787	D82E	unknown	Het
Smgc	A	T	15: 91,852,608	I463F	possibly damaging	Het
Strada	C	A	11: 106,171,039	G166C	probably damaging	Het
Tcaf3	A	G	6: 42,593,891	V309A	probably benign	Het
Tet2	C	T	3: 133,469,591	E1332K	possibly damaging	Het
Tfcp2l1	A	G	1: 118,668,632	N366D	probably damaging	Het
Tll2	G	A	19: 41,117,284	P369L	possibly damaging	Het
Tox4	T	C	14: 52,292,097	V505A	probably benign	Het
Trbv4	A	G	6: 41,059,853	D104G	probably damaging	Het
Ugdh	T	C	5: 65,417,037	E416G	probably damaging	Het
Usp47	T	A	7: 112,087,013	C613S	probably damaging	Het
Vmn1r11	T	A	6: 57,138,162	N270K	probably benign	Het
Wsb2	T	A	5: 117,371,095	L147Q	probably damaging	Het
Xrn1	G	A	9: 95,979,145	A453T	possibly damaging	Het
Zan	A	G	5: 137,461,844	S1262P	unknown	Het
Zswim4	A	G	8: 84,219,927	L700P	probably damaging	Het

Other mutations in Plcg1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00570:Plcg1	APN	2	160757266	missense	probably damaging	1.00
IGL00885:Plcg1	APN	2	160758083	missense	probably benign	0.03
IGL01066:Plcg1	APN	2	160754398	missense	probably damaging	1.00
IGL01356:Plcg1	APN	2	160753893	missense	probably damaging	1.00
IGL01629:Plcg1	APN	2	160758010	missense	possibly damaging	0.69
IGL01732:Plcg1	APN	2	160747779	missense	probably damaging	0.97
IGL01754:Plcg1	APN	2	160761433	missense	probably damaging	1.00
IGL02195:Plcg1	APN	2	160753926	missense	possibly damaging	0.83
IGL02371:Plcg1	APN	2	160753507	missense	probably damaging	0.99
IGL02671:Plcg1	APN	2	160755752	nonsense	probably null
IGL03096:Plcg1	APN	2	160757206	splice site	probably benign
IGL03129:Plcg1	APN	2	160774526	critical splice acceptor site	probably null
IGL03139:Plcg1	APN	2	160748129	critical splice donor site	probably null
IGL03211:Plcg1	APN	2	160759691	missense	possibly damaging	0.82
suscepit	UTSW	2	160753602	splice site	probably null
IGL03047:Plcg1	UTSW	2	160754879	missense	probably damaging	1.00
R0098:Plcg1	UTSW	2	160732000	missense	probably damaging	1.00
R0390:Plcg1	UTSW	2	160752366	missense	probably damaging	1.00
R0413:Plcg1	UTSW	2	160761429	missense	probably damaging	1.00
R0650:Plcg1	UTSW	2	160753363	splice site	probably benign
R0679:Plcg1	UTSW	2	160756910	missense	probably damaging	1.00
R0709:Plcg1	UTSW	2	160751778	splice site	probably null
R1719:Plcg1	UTSW	2	160753743	missense	probably null	0.94
R1721:Plcg1	UTSW	2	160731920	missense	probably damaging	0.99
R1727:Plcg1	UTSW	2	160748088	missense	probably benign	0.00
R1978:Plcg1	UTSW	2	160752578	splice site	probably null
R2277:Plcg1	UTSW	2	160755805	missense	possibly damaging	0.48
R2698:Plcg1	UTSW	2	160761463	missense	possibly damaging	0.90
R3832:Plcg1	UTSW	2	160754437	missense	possibly damaging	0.95
R4094:Plcg1	UTSW	2	160747841	missense	probably damaging	0.98
R4260:Plcg1	UTSW	2	160751707	critical splice donor site	probably null
R4622:Plcg1	UTSW	2	160747768	splice site	probably benign
R4837:Plcg1	UTSW	2	160750986	missense	probably benign	0.00
R4942:Plcg1	UTSW	2	160753589	splice site	probably null
R5514:Plcg1	UTSW	2	160753355	critical splice donor site	probably null
R5647:Plcg1	UTSW	2	160751668	missense	probably benign	0.45
R5929:Plcg1	UTSW	2	160753602	splice site	probably null
R6303:Plcg1	UTSW	2	160761463	missense	possibly damaging	0.90
R6304:Plcg1	UTSW	2	160761463	missense	possibly damaging	0.90
R6471:Plcg1	UTSW	2	160753710	missense	probably benign	0.10
R6500:Plcg1	UTSW	2	160754567	missense	probably damaging	1.00
R7017:Plcg1	UTSW	2	160758097	missense	probably damaging	1.00
R7113:Plcg1	UTSW	2	160748283	missense	possibly damaging	0.78
R7137:Plcg1	UTSW	2	160753926	missense	possibly damaging	0.83
R7211:Plcg1	UTSW	2	160731874	missense	probably benign	0.02
R7777:Plcg1	UTSW	2	160754603	missense	possibly damaging	0.89
R7918:Plcg1	UTSW	2	160753665	missense	probably damaging	1.00
R7934:Plcg1	UTSW	2	160774578	missense	possibly damaging	0.53
R8309:Plcg1	UTSW	2	160753933	missense	probably benign	0.00
R8344:Plcg1	UTSW	2	160747896	missense	probably benign	0.00
R8377:Plcg1	UTSW	2	160754922	missense	probably damaging	1.00
R8524:Plcg1	UTSW	2	160761467	critical splice donor site	probably null
R8708:Plcg1	UTSW	2	160754553	splice site	probably benign
R8831:Plcg1	UTSW	2	160747812	missense	probably benign	0.02
R8936:Plcg1	UTSW	2	160748066	missense	probably benign	0.02
R9414:Plcg1	UTSW	2	160761356	missense	possibly damaging	0.80
R9466:Plcg1	UTSW	2	160754600	missense	probably benign
R9608:Plcg1	UTSW	2	160755751	missense	probably benign	0.02
R9755:Plcg1	UTSW	2	160731860	missense	probably benign	0.27
Z1176:Plcg1	UTSW	2	160758127	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGCTTCTTTGGAGAATGGCC -3'
(R):5'- CGTGGTACCACCTGAAAACC -3'

Sequencing Primer
(F):5'- GAGAATGGCCTCCCTTTTTGAAATG -3'
(R):5'- ACCAACAGAGTTAGGCCCTGG -3'

Posted On

2019-06-26