Mutagenetix > Incidental Mutation

Incidental Mutation 'R7155:Arhgef11'

557198

Institutional Source

Beutler Lab

Gene Symbol

Arhgef11

Ensembl Gene

ENSMUSG00000041977

Gene Name

Rho guanine nucleotide exchange factor (GEF) 11

Synonyms

Prg, PDZ-RhoGEF

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7155 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

87617559-87738034 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 87709572 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 383 (Y383*)

Ref Sequence

ENSEMBL: ENSMUSP00000039900 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039476] [ENSMUST00000129113] [ENSMUST00000152006]

AlphaFold

Q68FM7

Predicted Effect

probably null
Transcript: ENSMUST00000039476
AA Change: Y383*

SMART Domains

Protein: ENSMUSP00000039900
Gene: ENSMUSG00000041977
AA Change: Y383*

Domain	Start	End	E-Value	Type
low complexity region	12	18	N/A	INTRINSIC
PDZ	55	123	2.45e-18	SMART
low complexity region	149	160	N/A	INTRINSIC
coiled coil region	205	231	N/A	INTRINSIC
RGS	353	472	3.36e-11	SMART
low complexity region	554	565	N/A	INTRINSIC
low complexity region	625	639	N/A	INTRINSIC
low complexity region	681	694	N/A	INTRINSIC
RhoGEF	768	952	1.11e-65	SMART
PH	996	1111	9.49e-6	SMART
low complexity region	1153	1166	N/A	INTRINSIC
low complexity region	1176	1188	N/A	INTRINSIC
low complexity region	1333	1343	N/A	INTRINSIC
low complexity region	1357	1367	N/A	INTRINSIC
low complexity region	1478	1490	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000129113
AA Change: Y343*

SMART Domains

Protein: ENSMUSP00000118123
Gene: ENSMUSG00000041977
AA Change: Y343*

Domain	Start	End	E-Value	Type
low complexity region	12	18	N/A	INTRINSIC
PDZ	55	123	2.45e-18	SMART
low complexity region	149	160	N/A	INTRINSIC
RGS	313	432	3.36e-11	SMART
low complexity region	596	610	N/A	INTRINSIC
low complexity region	652	665	N/A	INTRINSIC
RhoGEF	739	923	1.11e-65	SMART
PH	967	1082	9.49e-6	SMART
low complexity region	1124	1137	N/A	INTRINSIC
low complexity region	1147	1159	N/A	INTRINSIC
low complexity region	1304	1314	N/A	INTRINSIC
low complexity region	1328	1338	N/A	INTRINSIC
low complexity region	1449	1461	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000152006
AA Change: Y383*

SMART Domains

Protein: ENSMUSP00000122166
Gene: ENSMUSG00000041977
AA Change: Y383*

Domain	Start	End	E-Value	Type
low complexity region	12	18	N/A	INTRINSIC
PDZ	55	123	2.45e-18	SMART
low complexity region	149	160	N/A	INTRINSIC
coiled coil region	205	231	N/A	INTRINSIC
RGS	353	472	3.36e-11	SMART
low complexity region	554	565	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. A similar protein in rat interacts with glutamate transporter EAAT4 and modulates its glutamate transport activity. Expression of the rat protein induces the reorganization of the actin cytoskeleton and its overexpression induces the formation of membrane ruffling and filopodia. Two alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no obvious phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	A	G	2: 151,473,569	L63P	possibly damaging	Het
Abca13	A	T	11: 9,529,010	Y4286F	probably benign	Het
Aldh5a1	A	C	13: 24,911,589	V515G	possibly damaging	Het
Ankrd42	T	C	7: 92,591,933	E406G	possibly damaging	Het
Arfgef2	T	A	2: 166,865,813	M1043K	probably benign	Het
Aste1	C	T	9: 105,405,136	P614L	probably damaging	Het
B3galt5	T	A	16: 96,315,805	S213T	probably damaging	Het
Bak1	A	G	17: 27,022,460	L108P	possibly damaging	Het
Bcl6	G	A	16: 23,966,226	R675*	probably null	Het
Bdp1	T	G	13: 100,061,151	T909P	possibly damaging	Het
Cacna1i	A	G	15: 80,395,238	H2060R	probably benign	Het
Cdhr3	G	T	12: 33,061,773	P246Q	probably damaging	Het
Colgalt1	T	C	8: 71,623,710	S602P	probably damaging	Het
Csde1	T	C	3: 103,039,953	S74P	probably damaging	Het
Cyp51	A	T	5: 4,087,846	C366S	possibly damaging	Het
Dcaf7	A	G	11: 106,037,190	N23D	probably damaging	Het
Ddx10	G	A	9: 53,117,288	A772V	probably benign	Het
Ddx4	A	G	13: 112,613,785	F404S	probably benign	Het
Dirc2	G	T	16: 35,735,577	T171K	probably benign	Het
Dlg4	T	A	11: 70,017,216	M1K	probably null	Het
Dnajc6	T	C	4: 101,612,945	V293A	probably damaging	Het
Etl4	G	T	2: 20,806,931	R1643L	probably damaging	Het
F13b	G	A	1: 139,508,157	E234K	probably damaging	Het
Fam171a1	T	C	2: 3,225,729	I633T	probably benign	Het
Frem3	A	G	8: 80,616,039	I1654V	probably benign	Het
Galr2	A	G	11: 116,283,582	E346G	possibly damaging	Het
Gck	G	A	11: 5,949,705		probably benign	Het
Gen1	G	T	12: 11,241,832	T717K	probably benign	Het
Gm13083	A	T	4: 143,616,165	I281F	probably benign	Het
Gpatch8	TTCCTCCTCCTCCTCTTCCTCCTCCTC	TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC	11: 102,480,188		probably benign	Het
Hat1	A	G	2: 71,421,251	T215A	possibly damaging	Het
Hmbox1	A	T	14: 64,897,037	M38K	probably damaging	Het
Ifi47	A	G	11: 49,096,542	K379E	probably benign	Het
Ift81	T	C	5: 122,568,999	Y460C	probably damaging	Het
Jarid2	T	A	13: 44,902,462	S381R	probably damaging	Het
Kmt2b	A	T	7: 30,579,963	V1458E	probably damaging	Het
Kpna4	G	T	3: 69,089,933	P336Q	probably damaging	Het
Krt84	T	C	15: 101,532,254	R168G	probably damaging	Het
Lhx8	T	A	3: 154,324,584	Y137F	possibly damaging	Het
Lin7b	T	C	7: 45,370,227	E19G	probably damaging	Het
Lrmda	A	T	14: 22,584,540	R131S	probably damaging	Het
Lrrc75b	C	T	10: 75,553,678	A280T	possibly damaging	Het
Megf11	G	A	9: 64,647,951	R268K	probably null	Het
Mgat4e	G	T	1: 134,541,959	Q116K	probably damaging	Het
Mlkl	A	G	8: 111,319,403	L325P	probably damaging	Het
Mup2	A	G	4: 60,137,641	L134P	probably damaging	Het
Myo19	A	G	11: 84,900,586	E489G	probably damaging	Het
Ncbp3	C	A	11: 73,048,009	P37Q	probably damaging	Het
Nf2	A	G	11: 4,799,964	V236A	probably damaging	Het
Nlrp1a	A	T	11: 71,124,079	M115K	possibly damaging	Het
Nsf	T	A	11: 103,828,530	K649*	probably null	Het
Olfml2b	A	T	1: 170,666,785	I313L	probably benign	Het
Olfr316	T	A	11: 58,758,283	I206N	probably damaging	Het
Olfr654	T	A	7: 104,588,557	V251D	possibly damaging	Het
Papln	T	A	12: 83,776,521	L444Q	probably damaging	Het
Phc3	T	C	3: 30,914,197	I897V	probably benign	Het
Plcg1	T	C	2: 160,754,380	L632P	probably damaging	Het
Prkg1	T	C	19: 31,302,301	T178A	probably damaging	Het
Ptges	T	A	2: 30,892,804	T79S	probably benign	Het
Rab26	T	C	17: 24,532,289	T81A	probably damaging	Het
Rai14	T	A	15: 10,595,003	I145L	possibly damaging	Het
Rasgrf1	A	G	9: 90,002,361	T960A	possibly damaging	Het
Rfx1	A	T	8: 84,094,826	I755F	probably damaging	Het
Rims1	T	G	1: 22,432,923	L670F	probably damaging	Het
Rtkn	G	A	6: 83,149,711	C297Y	probably damaging	Het
Sec23a	A	T	12: 58,989,443	N378K	probably benign	Het
Slc17a2	A	G	13: 23,822,407	E472G	probably benign	Het
Slc1a2	T	C	2: 102,766,995	M449T	probably damaging	Het
Slc22a3	G	A	17: 12,433,631	L369F	possibly damaging	Het
Smad6	G	T	9: 64,021,787	D82E	unknown	Het
Smgc	A	T	15: 91,852,608	I463F	possibly damaging	Het
Strada	C	A	11: 106,171,039	G166C	probably damaging	Het
Tcaf3	A	G	6: 42,593,891	V309A	probably benign	Het
Tet2	C	T	3: 133,469,591	E1332K	possibly damaging	Het
Tfcp2l1	A	G	1: 118,668,632	N366D	probably damaging	Het
Tll2	G	A	19: 41,117,284	P369L	possibly damaging	Het
Tox4	T	C	14: 52,292,097	V505A	probably benign	Het
Trbv4	A	G	6: 41,059,853	D104G	probably damaging	Het
Ugdh	T	C	5: 65,417,037	E416G	probably damaging	Het
Usp47	T	A	7: 112,087,013	C613S	probably damaging	Het
Vmn1r11	T	A	6: 57,138,162	N270K	probably benign	Het
Wsb2	T	A	5: 117,371,095	L147Q	probably damaging	Het
Xrn1	G	A	9: 95,979,145	A453T	possibly damaging	Het
Zan	A	G	5: 137,461,844	S1262P	unknown	Het
Zswim4	A	G	8: 84,219,927	L700P	probably damaging	Het

Other mutations in Arhgef11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Arhgef11	APN	3	87729503	missense	probably damaging	1.00
IGL00900:Arhgef11	APN	3	87683560	missense	possibly damaging	0.71
IGL01291:Arhgef11	APN	3	87733174	missense	probably benign	0.00
IGL01475:Arhgef11	APN	3	87727126	splice site	probably benign
IGL01599:Arhgef11	APN	3	87737046	missense	probably benign
IGL02251:Arhgef11	APN	3	87683547	missense	probably damaging	1.00
IGL02651:Arhgef11	APN	3	87698864	missense	probably damaging	0.99
IGL02884:Arhgef11	APN	3	87728006	missense	probably damaging	1.00
IGL02900:Arhgef11	APN	3	87733160	missense	probably benign	0.07
IGL03017:Arhgef11	APN	3	87717060	nonsense	probably null
ANU05:Arhgef11	UTSW	3	87733174	missense	probably benign	0.00
R0049:Arhgef11	UTSW	3	87729193	splice site	probably null
R0049:Arhgef11	UTSW	3	87729193	splice site	probably null
R0129:Arhgef11	UTSW	3	87728063	missense	probably damaging	1.00
R0486:Arhgef11	UTSW	3	87688852	splice site	probably null
R0698:Arhgef11	UTSW	3	87733459	missense	probably benign	0.24
R0701:Arhgef11	UTSW	3	87733459	missense	probably benign	0.24
R0849:Arhgef11	UTSW	3	87735896	missense	probably benign	0.24
R1055:Arhgef11	UTSW	3	87717118	missense	probably benign	0.19
R1256:Arhgef11	UTSW	3	87727135	missense	possibly damaging	0.81
R1401:Arhgef11	UTSW	3	87733469	nonsense	probably null
R1543:Arhgef11	UTSW	3	87713017	missense	probably benign	0.10
R1547:Arhgef11	UTSW	3	87695402	missense	possibly damaging	0.87
R1564:Arhgef11	UTSW	3	87702510	missense	probably benign
R1675:Arhgef11	UTSW	3	87731211	missense	possibly damaging	0.84
R2082:Arhgef11	UTSW	3	87725996	missense	possibly damaging	0.47
R2293:Arhgef11	UTSW	3	87727990	missense	probably damaging	1.00
R4739:Arhgef11	UTSW	3	87697999	missense	possibly damaging	0.47
R4930:Arhgef11	UTSW	3	87728594	missense	probably damaging	1.00
R5130:Arhgef11	UTSW	3	87726014	missense	possibly damaging	0.71
R5151:Arhgef11	UTSW	3	87735360	missense	probably damaging	1.00
R5157:Arhgef11	UTSW	3	87728510	splice site	probably null
R5203:Arhgef11	UTSW	3	87735357	missense	probably damaging	1.00
R5329:Arhgef11	UTSW	3	87679752	intron	probably benign
R5615:Arhgef11	UTSW	3	87722485	critical splice donor site	probably null
R5646:Arhgef11	UTSW	3	87684486	missense	possibly damaging	0.94
R6125:Arhgef11	UTSW	3	87729602	missense	probably damaging	1.00
R6242:Arhgef11	UTSW	3	87728078	missense	probably benign
R6543:Arhgef11	UTSW	3	87733408	missense	probably benign	0.09
R6801:Arhgef11	UTSW	3	87735852	missense	possibly damaging	0.53
R6939:Arhgef11	UTSW	3	87686920	missense	probably damaging	1.00
R7008:Arhgef11	UTSW	3	87729218	missense	possibly damaging	0.92
R7169:Arhgef11	UTSW	3	87727448	missense	possibly damaging	0.79
R7325:Arhgef11	UTSW	3	87713292	missense	possibly damaging	0.62
R7392:Arhgef11	UTSW	3	87717175	critical splice donor site	probably null
R7683:Arhgef11	UTSW	3	87722383	missense	probably damaging	0.98
R7875:Arhgef11	UTSW	3	87684501	missense	probably damaging	1.00
R7912:Arhgef11	UTSW	3	87733222	missense	probably damaging	1.00
R7980:Arhgef11	UTSW	3	87697990	missense	probably benign	0.01
R8028:Arhgef11	UTSW	3	87735552	missense	probably benign
R8081:Arhgef11	UTSW	3	87725642	missense	probably damaging	1.00
R8118:Arhgef11	UTSW	3	87735857	missense	probably damaging	1.00
R8207:Arhgef11	UTSW	3	87698775	missense	possibly damaging	0.71
R8290:Arhgef11	UTSW	3	87725968	missense	probably damaging	1.00
R8443:Arhgef11	UTSW	3	87713099	missense	probably benign	0.17
R8543:Arhgef11	UTSW	3	87681874	missense	probably damaging	1.00
R8808:Arhgef11	UTSW	3	87686029	missense	probably damaging	1.00
R8969:Arhgef11	UTSW	3	87725642	missense	probably damaging	1.00
R8976:Arhgef11	UTSW	3	87728014	missense	probably benign
R8983:Arhgef11	UTSW	3	87733201	missense
R8987:Arhgef11	UTSW	3	87730481	missense	probably damaging	1.00
R9168:Arhgef11	UTSW	3	87726483	missense	probably damaging	1.00
R9498:Arhgef11	UTSW	3	87733177	missense	probably benign
R9741:Arhgef11	UTSW	3	87687849	missense	probably benign	0.03
X0011:Arhgef11	UTSW	3	87722406	missense	probably benign
Z1176:Arhgef11	UTSW	3	87735462	missense	not run

Predicted Primers

PCR Primer
(F):5'- GGGGAGGTTGTCTTAATTTGAAGATA -3'
(R):5'- GCACCAGCCTAGTGAACACA -3'

Sequencing Primer
(F):5'- ATATTTACCACTTACTGGACTCTACC -3'
(R):5'- ACAAACCCCGTCTCTATTTAGC -3'

Posted On

2019-06-26