Incidental Mutation 'R7155:Arhgef11'
ID557198
Institutional Source Beutler Lab
Gene Symbol Arhgef11
Ensembl Gene ENSMUSG00000041977
Gene NameRho guanine nucleotide exchange factor (GEF) 11
SynonymsPrg, PDZ-RhoGEF
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7155 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location87617559-87738034 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 87709572 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 383 (Y383*)
Ref Sequence ENSEMBL: ENSMUSP00000039900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039476] [ENSMUST00000129113] [ENSMUST00000152006]
Predicted Effect probably null
Transcript: ENSMUST00000039476
AA Change: Y383*
SMART Domains Protein: ENSMUSP00000039900
Gene: ENSMUSG00000041977
AA Change: Y383*

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
PDZ 55 123 2.45e-18 SMART
low complexity region 149 160 N/A INTRINSIC
coiled coil region 205 231 N/A INTRINSIC
RGS 353 472 3.36e-11 SMART
low complexity region 554 565 N/A INTRINSIC
low complexity region 625 639 N/A INTRINSIC
low complexity region 681 694 N/A INTRINSIC
RhoGEF 768 952 1.11e-65 SMART
PH 996 1111 9.49e-6 SMART
low complexity region 1153 1166 N/A INTRINSIC
low complexity region 1176 1188 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1357 1367 N/A INTRINSIC
low complexity region 1478 1490 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000129113
AA Change: Y343*
SMART Domains Protein: ENSMUSP00000118123
Gene: ENSMUSG00000041977
AA Change: Y343*

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
PDZ 55 123 2.45e-18 SMART
low complexity region 149 160 N/A INTRINSIC
RGS 313 432 3.36e-11 SMART
low complexity region 596 610 N/A INTRINSIC
low complexity region 652 665 N/A INTRINSIC
RhoGEF 739 923 1.11e-65 SMART
PH 967 1082 9.49e-6 SMART
low complexity region 1124 1137 N/A INTRINSIC
low complexity region 1147 1159 N/A INTRINSIC
low complexity region 1304 1314 N/A INTRINSIC
low complexity region 1328 1338 N/A INTRINSIC
low complexity region 1449 1461 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000152006
AA Change: Y383*
SMART Domains Protein: ENSMUSP00000122166
Gene: ENSMUSG00000041977
AA Change: Y383*

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
PDZ 55 123 2.45e-18 SMART
low complexity region 149 160 N/A INTRINSIC
coiled coil region 205 231 N/A INTRINSIC
RGS 353 472 3.36e-11 SMART
low complexity region 554 565 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. A similar protein in rat interacts with glutamate transporter EAAT4 and modulates its glutamate transport activity. Expression of the rat protein induces the reorganization of the actin cytoskeleton and its overexpression induces the formation of membrane ruffling and filopodia. Two alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,473,569 L63P possibly damaging Het
Abca13 A T 11: 9,529,010 Y4286F probably benign Het
Aldh5a1 A C 13: 24,911,589 V515G possibly damaging Het
Ankrd42 T C 7: 92,591,933 E406G possibly damaging Het
Arfgef2 T A 2: 166,865,813 M1043K probably benign Het
Aste1 C T 9: 105,405,136 P614L probably damaging Het
B3galt5 T A 16: 96,315,805 S213T probably damaging Het
Bak1 A G 17: 27,022,460 L108P possibly damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Bdp1 T G 13: 100,061,151 T909P possibly damaging Het
Cacna1i A G 15: 80,395,238 H2060R probably benign Het
Cdhr3 G T 12: 33,061,773 P246Q probably damaging Het
Colgalt1 T C 8: 71,623,710 S602P probably damaging Het
Csde1 T C 3: 103,039,953 S74P probably damaging Het
Cyp51 A T 5: 4,087,846 C366S possibly damaging Het
Dcaf7 A G 11: 106,037,190 N23D probably damaging Het
Ddx10 G A 9: 53,117,288 A772V probably benign Het
Ddx4 A G 13: 112,613,785 F404S probably benign Het
Dirc2 G T 16: 35,735,577 T171K probably benign Het
Dlg4 T A 11: 70,017,216 M1K probably null Het
Dnajc6 T C 4: 101,612,945 V293A probably damaging Het
Etl4 G T 2: 20,806,931 R1643L probably damaging Het
F13b G A 1: 139,508,157 E234K probably damaging Het
Fam171a1 T C 2: 3,225,729 I633T probably benign Het
Frem3 A G 8: 80,616,039 I1654V probably benign Het
Galr2 A G 11: 116,283,582 E346G possibly damaging Het
Gck G A 11: 5,949,705 probably benign Het
Gen1 G T 12: 11,241,832 T717K probably benign Het
Gm13083 A T 4: 143,616,165 I281F probably benign Het
Gpatch8 TTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC 11: 102,480,188 probably benign Het
Hat1 A G 2: 71,421,251 T215A possibly damaging Het
Hmbox1 A T 14: 64,897,037 M38K probably damaging Het
Ifi47 A G 11: 49,096,542 K379E probably benign Het
Ift81 T C 5: 122,568,999 Y460C probably damaging Het
Jarid2 T A 13: 44,902,462 S381R probably damaging Het
Kmt2b A T 7: 30,579,963 V1458E probably damaging Het
Kpna4 G T 3: 69,089,933 P336Q probably damaging Het
Krt84 T C 15: 101,532,254 R168G probably damaging Het
Lhx8 T A 3: 154,324,584 Y137F possibly damaging Het
Lin7b T C 7: 45,370,227 E19G probably damaging Het
Lrmda A T 14: 22,584,540 R131S probably damaging Het
Lrrc75b C T 10: 75,553,678 A280T possibly damaging Het
Megf11 G A 9: 64,647,951 R268K probably null Het
Mgat4e G T 1: 134,541,959 Q116K probably damaging Het
Mlkl A G 8: 111,319,403 L325P probably damaging Het
Mup2 A G 4: 60,137,641 L134P probably damaging Het
Myo19 A G 11: 84,900,586 E489G probably damaging Het
Ncbp3 C A 11: 73,048,009 P37Q probably damaging Het
Nf2 A G 11: 4,799,964 V236A probably damaging Het
Nlrp1a A T 11: 71,124,079 M115K possibly damaging Het
Nsf T A 11: 103,828,530 K649* probably null Het
Olfml2b A T 1: 170,666,785 I313L probably benign Het
Olfr316 T A 11: 58,758,283 I206N probably damaging Het
Olfr654 T A 7: 104,588,557 V251D possibly damaging Het
Papln T A 12: 83,776,521 L444Q probably damaging Het
Phc3 T C 3: 30,914,197 I897V probably benign Het
Plcg1 T C 2: 160,754,380 L632P probably damaging Het
Prkg1 T C 19: 31,302,301 T178A probably damaging Het
Ptges T A 2: 30,892,804 T79S probably benign Het
Rab26 T C 17: 24,532,289 T81A probably damaging Het
Rai14 T A 15: 10,595,003 I145L possibly damaging Het
Rasgrf1 A G 9: 90,002,361 T960A possibly damaging Het
Rfx1 A T 8: 84,094,826 I755F probably damaging Het
Rims1 T G 1: 22,432,923 L670F probably damaging Het
Rtkn G A 6: 83,149,711 C297Y probably damaging Het
Sec23a A T 12: 58,989,443 N378K probably benign Het
Slc17a2 A G 13: 23,822,407 E472G probably benign Het
Slc1a2 T C 2: 102,766,995 M449T probably damaging Het
Slc22a3 G A 17: 12,433,631 L369F possibly damaging Het
Smad6 G T 9: 64,021,787 D82E unknown Het
Smgc A T 15: 91,852,608 I463F possibly damaging Het
Strada C A 11: 106,171,039 G166C probably damaging Het
Tcaf3 A G 6: 42,593,891 V309A probably benign Het
Tet2 C T 3: 133,469,591 E1332K possibly damaging Het
Tfcp2l1 A G 1: 118,668,632 N366D probably damaging Het
Tll2 G A 19: 41,117,284 P369L possibly damaging Het
Tox4 T C 14: 52,292,097 V505A probably benign Het
Trbv4 A G 6: 41,059,853 D104G probably damaging Het
Ugdh T C 5: 65,417,037 E416G probably damaging Het
Usp47 T A 7: 112,087,013 C613S probably damaging Het
Vmn1r11 T A 6: 57,138,162 N270K probably benign Het
Wsb2 T A 5: 117,371,095 L147Q probably damaging Het
Xrn1 G A 9: 95,979,145 A453T possibly damaging Het
Zan A G 5: 137,461,844 S1262P unknown Het
Zswim4 A G 8: 84,219,927 L700P probably damaging Het
Other mutations in Arhgef11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Arhgef11 APN 3 87729503 missense probably damaging 1.00
IGL00900:Arhgef11 APN 3 87683560 missense possibly damaging 0.71
IGL01291:Arhgef11 APN 3 87733174 missense probably benign 0.00
IGL01475:Arhgef11 APN 3 87727126 splice site probably benign
IGL01599:Arhgef11 APN 3 87737046 missense probably benign
IGL02251:Arhgef11 APN 3 87683547 missense probably damaging 1.00
IGL02651:Arhgef11 APN 3 87698864 missense probably damaging 0.99
IGL02884:Arhgef11 APN 3 87728006 missense probably damaging 1.00
IGL02900:Arhgef11 APN 3 87733160 missense probably benign 0.07
IGL03017:Arhgef11 APN 3 87717060 nonsense probably null
ANU05:Arhgef11 UTSW 3 87733174 missense probably benign 0.00
R0049:Arhgef11 UTSW 3 87729193 splice site probably null
R0049:Arhgef11 UTSW 3 87729193 splice site probably null
R0129:Arhgef11 UTSW 3 87728063 missense probably damaging 1.00
R0486:Arhgef11 UTSW 3 87688852 unclassified probably null
R0698:Arhgef11 UTSW 3 87733459 missense probably benign 0.24
R0701:Arhgef11 UTSW 3 87733459 missense probably benign 0.24
R0849:Arhgef11 UTSW 3 87735896 missense probably benign 0.24
R1055:Arhgef11 UTSW 3 87717118 missense probably benign 0.19
R1256:Arhgef11 UTSW 3 87727135 missense possibly damaging 0.81
R1401:Arhgef11 UTSW 3 87733469 nonsense probably null
R1543:Arhgef11 UTSW 3 87713017 missense probably benign 0.10
R1547:Arhgef11 UTSW 3 87695402 missense possibly damaging 0.87
R1564:Arhgef11 UTSW 3 87702510 missense probably benign
R1675:Arhgef11 UTSW 3 87731211 missense possibly damaging 0.84
R2082:Arhgef11 UTSW 3 87725996 missense possibly damaging 0.47
R2293:Arhgef11 UTSW 3 87727990 missense probably damaging 1.00
R4739:Arhgef11 UTSW 3 87697999 missense possibly damaging 0.47
R4930:Arhgef11 UTSW 3 87728594 missense probably damaging 1.00
R5130:Arhgef11 UTSW 3 87726014 missense possibly damaging 0.71
R5151:Arhgef11 UTSW 3 87735360 missense probably damaging 1.00
R5157:Arhgef11 UTSW 3 87728510 splice site probably null
R5203:Arhgef11 UTSW 3 87735357 missense probably damaging 1.00
R5329:Arhgef11 UTSW 3 87679752 intron probably benign
R5615:Arhgef11 UTSW 3 87722485 critical splice donor site probably null
R5646:Arhgef11 UTSW 3 87684486 missense possibly damaging 0.94
R6125:Arhgef11 UTSW 3 87729602 missense probably damaging 1.00
R6242:Arhgef11 UTSW 3 87728078 missense probably benign
R6543:Arhgef11 UTSW 3 87733408 missense probably benign 0.09
R6801:Arhgef11 UTSW 3 87735852 missense possibly damaging 0.53
R6939:Arhgef11 UTSW 3 87686920 missense probably damaging 1.00
R7008:Arhgef11 UTSW 3 87729218 missense possibly damaging 0.92
R7169:Arhgef11 UTSW 3 87727448 missense possibly damaging 0.79
R7325:Arhgef11 UTSW 3 87713292 missense possibly damaging 0.62
R7392:Arhgef11 UTSW 3 87717175 critical splice donor site probably null
R7683:Arhgef11 UTSW 3 87722383 missense probably damaging 0.98
R7875:Arhgef11 UTSW 3 87684501 missense probably damaging 1.00
R7912:Arhgef11 UTSW 3 87733222 missense probably damaging 1.00
R8028:Arhgef11 UTSW 3 87735552 missense probably benign
R8081:Arhgef11 UTSW 3 87725642 missense probably damaging 1.00
R8118:Arhgef11 UTSW 3 87735857 missense probably damaging 1.00
R8207:Arhgef11 UTSW 3 87698775 missense possibly damaging 0.71
R8290:Arhgef11 UTSW 3 87725968 missense probably damaging 1.00
X0011:Arhgef11 UTSW 3 87722406 missense probably benign
Z1176:Arhgef11 UTSW 3 87735462 missense not run
Predicted Primers PCR Primer
(F):5'- GGGGAGGTTGTCTTAATTTGAAGATA -3'
(R):5'- GCACCAGCCTAGTGAACACA -3'

Sequencing Primer
(F):5'- ATATTTACCACTTACTGGACTCTACC -3'
(R):5'- ACAAACCCCGTCTCTATTTAGC -3'
Posted On2019-06-26