Incidental Mutation 'R7155:Dnajc6'
ID557203
Institutional Source Beutler Lab
Gene Symbol Dnajc6
Ensembl Gene ENSMUSG00000028528
Gene NameDnaJ heat shock protein family (Hsp40) member C6
Synonymsauxilin, 2810027M23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R7155 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location101496648-101642799 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101612945 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 293 (V293A)
Ref Sequence ENSEMBL: ENSMUSP00000102546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038207] [ENSMUST00000094953] [ENSMUST00000106929] [ENSMUST00000106930] [ENSMUST00000106933] [ENSMUST00000149047]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038207
AA Change: V263A

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044251
Gene: ENSMUSG00000028528
AA Change: V263A

DomainStartEndE-ValueType
SCOP:d1d5ra2 88 244 1e-20 SMART
PTEN_C2 251 390 5.95e-42 SMART
low complexity region 502 521 N/A INTRINSIC
low complexity region 554 569 N/A INTRINSIC
low complexity region 679 694 N/A INTRINSIC
low complexity region 719 735 N/A INTRINSIC
low complexity region 829 840 N/A INTRINSIC
DnaJ 873 934 2e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000094953
AA Change: V225A

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092560
Gene: ENSMUSG00000028528
AA Change: V225A

DomainStartEndE-ValueType
SCOP:d1d5ra2 50 206 2e-20 SMART
PTEN_C2 213 352 5.95e-42 SMART
low complexity region 464 483 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
low complexity region 641 656 N/A INTRINSIC
low complexity region 681 697 N/A INTRINSIC
low complexity region 791 802 N/A INTRINSIC
DnaJ 835 896 2e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106929
AA Change: V225A

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102542
Gene: ENSMUSG00000028528
AA Change: V225A

DomainStartEndE-ValueType
SCOP:d1d5ra2 50 206 2e-20 SMART
PTEN_C2 213 352 5.95e-42 SMART
low complexity region 464 483 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
low complexity region 641 656 N/A INTRINSIC
low complexity region 681 697 N/A INTRINSIC
low complexity region 791 802 N/A INTRINSIC
DnaJ 835 896 2e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106930
AA Change: V225A

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102543
Gene: ENSMUSG00000028528
AA Change: V225A

DomainStartEndE-ValueType
SCOP:d1d5ra2 50 206 2e-20 SMART
PTEN_C2 213 352 5.95e-42 SMART
low complexity region 464 483 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
low complexity region 641 656 N/A INTRINSIC
low complexity region 681 697 N/A INTRINSIC
low complexity region 791 802 N/A INTRINSIC
DnaJ 835 896 2e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106933
AA Change: V293A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102546
Gene: ENSMUSG00000028528
AA Change: V293A

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
SCOP:d1d5ra2 118 274 1e-20 SMART
PTEN_C2 281 420 5.95e-42 SMART
low complexity region 532 551 N/A INTRINSIC
low complexity region 584 599 N/A INTRINSIC
low complexity region 709 724 N/A INTRINSIC
low complexity region 749 765 N/A INTRINSIC
low complexity region 859 870 N/A INTRINSIC
DnaJ 903 964 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149047
SMART Domains Protein: ENSMUSP00000119542
Gene: ENSMUSG00000028528

DomainStartEndE-ValueType
PDB:3N0A|A 30 194 1e-118 PDB
SCOP:d1d5ra2 50 187 2e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNAJC6 belongs to the evolutionarily conserved DNAJ/HSP40 family of proteins, which regulate molecular chaperone activity by stimulating ATPase activity. DNAJ proteins may have up to 3 distinct domains: a conserved 70-amino acid J domain, usually at the N terminus, a glycine/phenylalanine (G/F)-rich region, and a cysteine-rich domain containing 4 motifs resembling a zinc finger domain (Ohtsuka and Hata, 2000 [PubMed 11147971]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous and heterozygous for a knock-out allele exhibit postnatal lethality and decreased body weight with homozygotes exhibiting decreased synpatic vesicle recycling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,473,569 L63P possibly damaging Het
Abca13 A T 11: 9,529,010 Y4286F probably benign Het
Aldh5a1 A C 13: 24,911,589 V515G possibly damaging Het
Ankrd42 T C 7: 92,591,933 E406G possibly damaging Het
Arfgef2 T A 2: 166,865,813 M1043K probably benign Het
Arhgef11 T A 3: 87,709,572 Y383* probably null Het
Aste1 C T 9: 105,405,136 P614L probably damaging Het
B3galt5 T A 16: 96,315,805 S213T probably damaging Het
Bak1 A G 17: 27,022,460 L108P possibly damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Bdp1 T G 13: 100,061,151 T909P possibly damaging Het
Cacna1i A G 15: 80,395,238 H2060R probably benign Het
Cdhr3 G T 12: 33,061,773 P246Q probably damaging Het
Colgalt1 T C 8: 71,623,710 S602P probably damaging Het
Csde1 T C 3: 103,039,953 S74P probably damaging Het
Cyp51 A T 5: 4,087,846 C366S possibly damaging Het
Dcaf7 A G 11: 106,037,190 N23D probably damaging Het
Ddx10 G A 9: 53,117,288 A772V probably benign Het
Ddx4 A G 13: 112,613,785 F404S probably benign Het
Dirc2 G T 16: 35,735,577 T171K probably benign Het
Dlg4 T A 11: 70,017,216 M1K probably null Het
Etl4 G T 2: 20,806,931 R1643L probably damaging Het
F13b G A 1: 139,508,157 E234K probably damaging Het
Fam171a1 T C 2: 3,225,729 I633T probably benign Het
Frem3 A G 8: 80,616,039 I1654V probably benign Het
Galr2 A G 11: 116,283,582 E346G possibly damaging Het
Gck G A 11: 5,949,705 probably benign Het
Gen1 G T 12: 11,241,832 T717K probably benign Het
Gm13083 A T 4: 143,616,165 I281F probably benign Het
Gpatch8 TTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC 11: 102,480,188 probably benign Het
Hat1 A G 2: 71,421,251 T215A possibly damaging Het
Hmbox1 A T 14: 64,897,037 M38K probably damaging Het
Ifi47 A G 11: 49,096,542 K379E probably benign Het
Ift81 T C 5: 122,568,999 Y460C probably damaging Het
Jarid2 T A 13: 44,902,462 S381R probably damaging Het
Kmt2b A T 7: 30,579,963 V1458E probably damaging Het
Kpna4 G T 3: 69,089,933 P336Q probably damaging Het
Krt84 T C 15: 101,532,254 R168G probably damaging Het
Lhx8 T A 3: 154,324,584 Y137F possibly damaging Het
Lin7b T C 7: 45,370,227 E19G probably damaging Het
Lrmda A T 14: 22,584,540 R131S probably damaging Het
Lrrc75b C T 10: 75,553,678 A280T possibly damaging Het
Megf11 G A 9: 64,647,951 R268K probably null Het
Mgat4e G T 1: 134,541,959 Q116K probably damaging Het
Mlkl A G 8: 111,319,403 L325P probably damaging Het
Mup2 A G 4: 60,137,641 L134P probably damaging Het
Myo19 A G 11: 84,900,586 E489G probably damaging Het
Ncbp3 C A 11: 73,048,009 P37Q probably damaging Het
Nf2 A G 11: 4,799,964 V236A probably damaging Het
Nlrp1a A T 11: 71,124,079 M115K possibly damaging Het
Nsf T A 11: 103,828,530 K649* probably null Het
Olfml2b A T 1: 170,666,785 I313L probably benign Het
Olfr316 T A 11: 58,758,283 I206N probably damaging Het
Olfr654 T A 7: 104,588,557 V251D possibly damaging Het
Papln T A 12: 83,776,521 L444Q probably damaging Het
Phc3 T C 3: 30,914,197 I897V probably benign Het
Plcg1 T C 2: 160,754,380 L632P probably damaging Het
Prkg1 T C 19: 31,302,301 T178A probably damaging Het
Ptges T A 2: 30,892,804 T79S probably benign Het
Rab26 T C 17: 24,532,289 T81A probably damaging Het
Rai14 T A 15: 10,595,003 I145L possibly damaging Het
Rasgrf1 A G 9: 90,002,361 T960A possibly damaging Het
Rfx1 A T 8: 84,094,826 I755F probably damaging Het
Rims1 T G 1: 22,432,923 L670F probably damaging Het
Rtkn G A 6: 83,149,711 C297Y probably damaging Het
Sec23a A T 12: 58,989,443 N378K probably benign Het
Slc17a2 A G 13: 23,822,407 E472G probably benign Het
Slc1a2 T C 2: 102,766,995 M449T probably damaging Het
Slc22a3 G A 17: 12,433,631 L369F possibly damaging Het
Smad6 G T 9: 64,021,787 D82E unknown Het
Smgc A T 15: 91,852,608 I463F possibly damaging Het
Strada C A 11: 106,171,039 G166C probably damaging Het
Tcaf3 A G 6: 42,593,891 V309A probably benign Het
Tet2 C T 3: 133,469,591 E1332K possibly damaging Het
Tfcp2l1 A G 1: 118,668,632 N366D probably damaging Het
Tll2 G A 19: 41,117,284 P369L possibly damaging Het
Tox4 T C 14: 52,292,097 V505A probably benign Het
Trbv4 A G 6: 41,059,853 D104G probably damaging Het
Ugdh T C 5: 65,417,037 E416G probably damaging Het
Usp47 T A 7: 112,087,013 C613S probably damaging Het
Vmn1r11 T A 6: 57,138,162 N270K probably benign Het
Wsb2 T A 5: 117,371,095 L147Q probably damaging Het
Xrn1 G A 9: 95,979,145 A453T possibly damaging Het
Zan A G 5: 137,461,844 S1262P unknown Het
Zswim4 A G 8: 84,219,927 L700P probably damaging Het
Other mutations in Dnajc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Dnajc6 APN 4 101508089 intron probably benign
IGL02336:Dnajc6 APN 4 101614286 unclassified probably null
IGL02551:Dnajc6 APN 4 101639353 missense probably damaging 1.00
IGL02801:Dnajc6 APN 4 101597813 missense probably benign 0.33
IGL02887:Dnajc6 APN 4 101639300 missense probably damaging 1.00
IGL03107:Dnajc6 APN 4 101616860 missense probably damaging 1.00
IGL03271:Dnajc6 APN 4 101508077 intron probably benign
R0091:Dnajc6 UTSW 4 101616777 splice site probably benign
R0384:Dnajc6 UTSW 4 101598956 missense probably damaging 1.00
R0546:Dnajc6 UTSW 4 101635191 missense probably damaging 0.99
R0689:Dnajc6 UTSW 4 101611253 missense possibly damaging 0.91
R1239:Dnajc6 UTSW 4 101635116 missense probably damaging 0.98
R1421:Dnajc6 UTSW 4 101611316 missense probably damaging 0.97
R1424:Dnajc6 UTSW 4 101639347 missense possibly damaging 0.92
R1563:Dnajc6 UTSW 4 101599137 missense probably damaging 1.00
R1608:Dnajc6 UTSW 4 101599167 missense probably damaging 1.00
R1757:Dnajc6 UTSW 4 101597831 missense probably damaging 1.00
R1856:Dnajc6 UTSW 4 101598988 missense probably damaging 1.00
R2032:Dnajc6 UTSW 4 101614238 missense probably benign 0.39
R2518:Dnajc6 UTSW 4 101612930 missense probably damaging 0.99
R4028:Dnajc6 UTSW 4 101616857 missense probably damaging 1.00
R4088:Dnajc6 UTSW 4 101639396 missense probably damaging 1.00
R4601:Dnajc6 UTSW 4 101611264 missense probably damaging 1.00
R4602:Dnajc6 UTSW 4 101611264 missense probably damaging 1.00
R4610:Dnajc6 UTSW 4 101611264 missense probably damaging 1.00
R4755:Dnajc6 UTSW 4 101550799 missense probably damaging 1.00
R4878:Dnajc6 UTSW 4 101599034 intron probably benign
R4938:Dnajc6 UTSW 4 101636813 missense probably damaging 1.00
R5373:Dnajc6 UTSW 4 101615627 missense probably damaging 0.99
R5391:Dnajc6 UTSW 4 101628158 critical splice donor site probably null
R5435:Dnajc6 UTSW 4 101606610 missense probably damaging 0.99
R5760:Dnajc6 UTSW 4 101618642 missense probably benign 0.39
R6044:Dnajc6 UTSW 4 101616577 missense probably benign 0.22
R6086:Dnajc6 UTSW 4 101597807 missense probably benign 0.45
R6460:Dnajc6 UTSW 4 101615598 missense probably damaging 1.00
R6495:Dnajc6 UTSW 4 101635065 nonsense probably null
R6956:Dnajc6 UTSW 4 101614273 missense probably damaging 0.97
R7072:Dnajc6 UTSW 4 101615615 missense probably damaging 1.00
R7192:Dnajc6 UTSW 4 101597803 missense probably benign 0.02
R7226:Dnajc6 UTSW 4 101639372 missense probably damaging 1.00
R7298:Dnajc6 UTSW 4 101606611 missense probably benign 0.09
R7612:Dnajc6 UTSW 4 101597926 missense probably benign 0.40
R7622:Dnajc6 UTSW 4 101640491 missense probably damaging 1.00
R7652:Dnajc6 UTSW 4 101606677 missense probably damaging 0.98
R7789:Dnajc6 UTSW 4 101618532 missense possibly damaging 0.82
Z1088:Dnajc6 UTSW 4 101639329 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGCTGTCTTAATTGTCTGTG -3'
(R):5'- GCAGGAGGAATGCAATTCACAC -3'

Sequencing Primer
(F):5'- AAGCTGTCTTAATTGTCTGTGTTTCC -3'
(R):5'- GCAATTCACACAGGAATTAAATATGC -3'
Posted On2019-06-26