Incidental Mutation 'R0585:Ccdc162'
ID55721
Institutional Source Beutler Lab
Gene Symbol Ccdc162
Ensembl Gene ENSMUSG00000075225
Gene Namecoiled-coil domain containing 162
Synonyms5033413D22Rik
MMRRC Submission 038775-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R0585 (G1)
Quality Score213
Status Validated
Chromosome10
Chromosomal Location41538846-41716634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 41586379 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 1474 (C1474Y)
Ref Sequence ENSEMBL: ENSMUSP00000140774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019955] [ENSMUST00000099932] [ENSMUST00000179614] [ENSMUST00000189488] [ENSMUST00000219054]
Predicted Effect probably benign
Transcript: ENSMUST00000019955
SMART Domains Protein: ENSMUSP00000019955
Gene: ENSMUSG00000075225

DomainStartEndE-ValueType
coiled coil region 1 37 N/A INTRINSIC
low complexity region 116 138 N/A INTRINSIC
coiled coil region 177 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099932
AA Change: C11Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097516
Gene: ENSMUSG00000075225
AA Change: C11Y

DomainStartEndE-ValueType
coiled coil region 327 366 N/A INTRINSIC
low complexity region 490 512 N/A INTRINSIC
coiled coil region 551 607 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160751
Predicted Effect probably benign
Transcript: ENSMUST00000179614
AA Change: C201Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000135966
Gene: ENSMUSG00000075225
AA Change: C201Y

DomainStartEndE-ValueType
coiled coil region 517 556 N/A INTRINSIC
low complexity region 680 702 N/A INTRINSIC
coiled coil region 741 797 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189488
AA Change: C1474Y

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000140774
Gene: ENSMUSG00000075225
AA Change: C1474Y

DomainStartEndE-ValueType
low complexity region 328 347 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219054
AA Change: C201Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.2%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,550,723 V267A probably benign Het
9530003J23Rik T A 10: 117,238,451 I44F possibly damaging Het
Brdt T G 5: 107,356,882 probably null Het
Ces2e T C 8: 104,929,821 S228P probably damaging Het
Clca1 G T 3: 145,032,625 H41N probably benign Het
Cyp2c39 A T 19: 39,536,759 I169F probably benign Het
Cyp2c65 A G 19: 39,069,242 K107R probably benign Het
Cyp2c67 T A 19: 39,638,694 N231Y possibly damaging Het
Eps8l3 G C 3: 107,881,197 D33H probably damaging Het
Evi5 T C 5: 107,813,536 probably benign Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Gm3993 T A 12: 20,072,148 probably null Het
Gtf2ird1 A C 5: 134,376,942 L28R probably damaging Het
Hsf4 A G 8: 105,271,031 D75G probably damaging Het
Larp4b A G 13: 9,147,493 T249A probably damaging Het
Larp4b A G 13: 9,170,701 D578G probably benign Het
Matn3 A T 12: 8,961,103 probably benign Het
Myo10 T A 15: 25,736,455 Y428N probably damaging Het
Nf1 T A 11: 79,568,701 D661E probably damaging Het
Nktr A G 9: 121,754,280 probably benign Het
Npbwr1 G A 1: 5,916,458 T279I possibly damaging Het
Olfr665 A C 7: 104,881,499 H264P probably damaging Het
Osmr T C 15: 6,837,793 I341V probably benign Het
Pan2 T C 10: 128,310,515 probably null Het
Pknox2 G A 9: 36,909,760 probably benign Het
Pla2g2d A C 4: 138,779,393 D50A probably benign Het
Ptprk C T 10: 28,575,668 L1051F probably damaging Het
Rap1gds1 G A 3: 139,021,872 T59M probably benign Het
Rps5 T C 7: 12,925,405 V41A possibly damaging Het
Ryr1 G T 7: 29,036,076 D4092E probably damaging Het
Spic T C 10: 88,676,043 Y117C probably damaging Het
Thrap3 A T 4: 126,178,574 probably null Het
Tlr9 C T 9: 106,225,076 T522I probably benign Het
Tspan3 A T 9: 56,145,932 probably benign Het
Ttn T C 2: 76,873,159 probably benign Het
Zfp773 T A 7: 7,132,575 I341L probably benign Het
Zmat3 G A 3: 32,361,105 P19S probably damaging Het
Other mutations in Ccdc162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Ccdc162 APN 10 41581339 missense probably benign 0.01
IGL01366:Ccdc162 APN 10 41580306 missense possibly damaging 0.49
IGL01924:Ccdc162 APN 10 41569887 missense probably damaging 1.00
IGL02504:Ccdc162 APN 10 41552388 missense probably damaging 1.00
IGL02678:Ccdc162 APN 10 41561155 missense probably damaging 0.99
IGL02955:Ccdc162 APN 10 41561127 missense probably damaging 1.00
beeswax UTSW 10 41561226 missense possibly damaging 0.57
honeycomb UTSW 10 41644641 missense probably benign 0.35
FR4304:Ccdc162 UTSW 10 41556121 missense possibly damaging 0.49
R0432:Ccdc162 UTSW 10 41541860 missense probably benign 0.01
R0645:Ccdc162 UTSW 10 41586411 splice site probably benign
R0731:Ccdc162 UTSW 10 41579143 missense probably damaging 1.00
R1426:Ccdc162 UTSW 10 41553182 missense possibly damaging 0.89
R1447:Ccdc162 UTSW 10 41580247 missense probably damaging 1.00
R1712:Ccdc162 UTSW 10 41539431 missense probably benign 0.35
R2138:Ccdc162 UTSW 10 41581297 missense probably benign 0.15
R2351:Ccdc162 UTSW 10 41555972 critical splice donor site probably null
R2394:Ccdc162 UTSW 10 41569898 missense probably damaging 1.00
R2431:Ccdc162 UTSW 10 41569845 missense probably benign
R2571:Ccdc162 UTSW 10 41552397 missense probably damaging 1.00
R2873:Ccdc162 UTSW 10 41655099 missense possibly damaging 0.68
R2926:Ccdc162 UTSW 10 41561207 start gained probably benign
R2999:Ccdc162 UTSW 10 41580290 missense probably benign 0.00
R3412:Ccdc162 UTSW 10 41539549 splice site probably benign
R3712:Ccdc162 UTSW 10 41587379 missense probably benign
R3736:Ccdc162 UTSW 10 41589568 intron probably null
R4112:Ccdc162 UTSW 10 41656328 missense possibly damaging 0.77
R4557:Ccdc162 UTSW 10 41587388 missense probably benign 0.01
R4580:Ccdc162 UTSW 10 41561140 missense probably benign 0.02
R4685:Ccdc162 UTSW 10 41681686 missense possibly damaging 0.89
R4837:Ccdc162 UTSW 10 41673867 missense probably benign 0.00
R5155:Ccdc162 UTSW 10 41553580 splice site probably null
R5155:Ccdc162 UTSW 10 41579151 missense probably damaging 1.00
R5645:Ccdc162 UTSW 10 41552356 missense probably benign 0.06
R5656:Ccdc162 UTSW 10 41569934 missense probably benign 0.26
R5682:Ccdc162 UTSW 10 41556803 nonsense probably null
R5808:Ccdc162 UTSW 10 41655504 missense possibly damaging 0.62
R5909:Ccdc162 UTSW 10 41561115 missense probably damaging 1.00
R6000:Ccdc162 UTSW 10 41561163 missense possibly damaging 0.75
R6057:Ccdc162 UTSW 10 41634041 missense possibly damaging 0.72
R6211:Ccdc162 UTSW 10 41630145 nonsense probably null
R6264:Ccdc162 UTSW 10 41694468 missense probably benign 0.31
R6329:Ccdc162 UTSW 10 41663151 missense possibly damaging 0.76
R6349:Ccdc162 UTSW 10 41694400 missense probably damaging 0.97
R6398:Ccdc162 UTSW 10 41627149 missense probably damaging 1.00
R6453:Ccdc162 UTSW 10 41550825 missense probably damaging 1.00
R6602:Ccdc162 UTSW 10 41615980 missense probably benign 0.00
R6627:Ccdc162 UTSW 10 41663185 missense probably damaging 1.00
R6722:Ccdc162 UTSW 10 41644641 missense probably benign 0.35
R6750:Ccdc162 UTSW 10 41561226 missense possibly damaging 0.57
R6968:Ccdc162 UTSW 10 41673844 missense possibly damaging 0.55
R6970:Ccdc162 UTSW 10 41615958 missense probably benign 0.03
R6989:Ccdc162 UTSW 10 41581353 missense probably damaging 0.99
R7008:Ccdc162 UTSW 10 41552415 missense probably damaging 1.00
R7135:Ccdc162 UTSW 10 41673859 missense probably benign 0.00
R7139:Ccdc162 UTSW 10 41666721 missense possibly damaging 0.49
R7224:Ccdc162 UTSW 10 41561191 missense probably damaging 1.00
R7230:Ccdc162 UTSW 10 41678813 missense probably damaging 1.00
R7256:Ccdc162 UTSW 10 41556001 missense probably damaging 0.99
R7261:Ccdc162 UTSW 10 41561140 missense probably benign 0.02
R7390:Ccdc162 UTSW 10 41634048 missense probably benign
R7712:Ccdc162 UTSW 10 41627227 missense possibly damaging 0.56
R7726:Ccdc162 UTSW 10 41553075 missense probably benign 0.00
R7754:Ccdc162 UTSW 10 41587375 missense probably damaging 1.00
R7764:Ccdc162 UTSW 10 41690113 missense possibly damaging 0.95
R8053:Ccdc162 UTSW 10 41644581 missense probably benign
R8088:Ccdc162 UTSW 10 41623414 missense possibly damaging 0.68
R8094:Ccdc162 UTSW 10 41612868 missense probably benign 0.02
R8097:Ccdc162 UTSW 10 41634119 missense probably benign 0.03
Z1176:Ccdc162 UTSW 10 41553131 missense probably benign 0.00
Z1176:Ccdc162 UTSW 10 41605108 missense possibly damaging 0.84
Z1176:Ccdc162 UTSW 10 41654997 missense possibly damaging 0.84
Z1176:Ccdc162 UTSW 10 41690092 missense probably benign 0.00
Z1177:Ccdc162 UTSW 10 41683195 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTTCTTGAGTACAGTGCAGCACC -3'
(R):5'- TGGGGCAAGGCTGGCAATACATTC -3'

Sequencing Primer
(F):5'- ACCAGCCACTCTGTAGCC -3'
(R):5'- TGAAGgtttttttgtttgtttgtttg -3'
Posted On2013-07-11