Incidental Mutation 'R7155:Tcaf3'
ID 557211
Institutional Source Beutler Lab
Gene Symbol Tcaf3
Ensembl Gene ENSMUSG00000018656
Gene Name TRPM8 channel-associated factor 3
Synonyms Eapa2, Fam115e
MMRRC Submission 045226-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.050) question?
Stock # R7155 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 42564147-42574306 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 42570825 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 309 (V309A)
Ref Sequence ENSEMBL: ENSMUSP00000064060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069023] [ENSMUST00000134707]
AlphaFold Q6QR59
Predicted Effect probably benign
Transcript: ENSMUST00000069023
AA Change: V309A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656
AA Change: V309A

DomainStartEndE-ValueType
internal_repeat_1 26 194 9.98e-16 PROSPERO
low complexity region 210 221 N/A INTRINSIC
internal_repeat_1 234 402 9.98e-16 PROSPERO
low complexity region 509 518 N/A INTRINSIC
M60-like 533 832 3.49e-130 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134707
SMART Domains Protein: ENSMUSP00000123321
Gene: ENSMUSG00000018656

DomainStartEndE-ValueType
low complexity region 210 221 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,315,489 (GRCm39) L63P possibly damaging Het
Abca13 A T 11: 9,479,010 (GRCm39) Y4286F probably benign Het
Aldh5a1 A C 13: 25,095,572 (GRCm39) V515G possibly damaging Het
Ankrd42 T C 7: 92,241,141 (GRCm39) E406G possibly damaging Het
Arfgef2 T A 2: 166,707,733 (GRCm39) M1043K probably benign Het
Arhgef11 T A 3: 87,616,879 (GRCm39) Y383* probably null Het
Aste1 C T 9: 105,282,335 (GRCm39) P614L probably damaging Het
B3galt5 T A 16: 96,117,005 (GRCm39) S213T probably damaging Het
Bak1 A G 17: 27,241,434 (GRCm39) L108P possibly damaging Het
Bcl6 G A 16: 23,784,976 (GRCm39) R675* probably null Het
Bdp1 T G 13: 100,197,659 (GRCm39) T909P possibly damaging Het
Cacna1i A G 15: 80,279,439 (GRCm39) H2060R probably benign Het
Cdhr3 G T 12: 33,111,772 (GRCm39) P246Q probably damaging Het
Colgalt1 T C 8: 72,076,354 (GRCm39) S602P probably damaging Het
Csde1 T C 3: 102,947,269 (GRCm39) S74P probably damaging Het
Cyp51 A T 5: 4,137,846 (GRCm39) C366S possibly damaging Het
Dcaf7 A G 11: 105,928,016 (GRCm39) N23D probably damaging Het
Ddx10 G A 9: 53,028,588 (GRCm39) A772V probably benign Het
Ddx4 A G 13: 112,750,319 (GRCm39) F404S probably benign Het
Dlg4 T A 11: 69,908,042 (GRCm39) M1K probably null Het
Dnajc6 T C 4: 101,470,142 (GRCm39) V293A probably damaging Het
Etl4 G T 2: 20,811,742 (GRCm39) R1643L probably damaging Het
F13b G A 1: 139,435,895 (GRCm39) E234K probably damaging Het
Fam171a1 T C 2: 3,226,766 (GRCm39) I633T probably benign Het
Frem3 A G 8: 81,342,668 (GRCm39) I1654V probably benign Het
Galr2 A G 11: 116,174,408 (GRCm39) E346G possibly damaging Het
Gck G A 11: 5,899,705 (GRCm39) probably benign Het
Gen1 G T 12: 11,291,833 (GRCm39) T717K probably benign Het
Gpatch8 TTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC 11: 102,371,014 (GRCm39) probably benign Het
Hat1 A G 2: 71,251,595 (GRCm39) T215A possibly damaging Het
Hmbox1 A T 14: 65,134,486 (GRCm39) M38K probably damaging Het
Ifi47 A G 11: 48,987,369 (GRCm39) K379E probably benign Het
Ift81 T C 5: 122,707,062 (GRCm39) Y460C probably damaging Het
Jarid2 T A 13: 45,055,938 (GRCm39) S381R probably damaging Het
Kmt2b A T 7: 30,279,388 (GRCm39) V1458E probably damaging Het
Kpna4 G T 3: 68,997,266 (GRCm39) P336Q probably damaging Het
Krt84 T C 15: 101,440,689 (GRCm39) R168G probably damaging Het
Lhx8 T A 3: 154,030,221 (GRCm39) Y137F possibly damaging Het
Lin7b T C 7: 45,019,651 (GRCm39) E19G probably damaging Het
Lrmda A T 14: 22,634,608 (GRCm39) R131S probably damaging Het
Lrrc75b C T 10: 75,389,512 (GRCm39) A280T possibly damaging Het
Megf11 G A 9: 64,555,233 (GRCm39) R268K probably null Het
Mgat4e G T 1: 134,469,697 (GRCm39) Q116K probably damaging Het
Mlkl A G 8: 112,046,035 (GRCm39) L325P probably damaging Het
Mup2 A G 4: 60,137,641 (GRCm39) L134P probably damaging Het
Myo19 A G 11: 84,791,412 (GRCm39) E489G probably damaging Het
Ncbp3 C A 11: 72,938,835 (GRCm39) P37Q probably damaging Het
Nf2 A G 11: 4,749,964 (GRCm39) V236A probably damaging Het
Nlrp1a A T 11: 71,014,905 (GRCm39) M115K possibly damaging Het
Nsf T A 11: 103,719,356 (GRCm39) K649* probably null Het
Olfml2b A T 1: 170,494,354 (GRCm39) I313L probably benign Het
Or2ak4 T A 11: 58,649,109 (GRCm39) I206N probably damaging Het
Or52u1 T A 7: 104,237,764 (GRCm39) V251D possibly damaging Het
Papln T A 12: 83,823,295 (GRCm39) L444Q probably damaging Het
Phc3 T C 3: 30,968,346 (GRCm39) I897V probably benign Het
Plcg1 T C 2: 160,596,300 (GRCm39) L632P probably damaging Het
Pramel21 A T 4: 143,342,735 (GRCm39) I281F probably benign Het
Prkg1 T C 19: 31,279,701 (GRCm39) T178A probably damaging Het
Ptges T A 2: 30,782,816 (GRCm39) T79S probably benign Het
Rab26 T C 17: 24,751,263 (GRCm39) T81A probably damaging Het
Rai14 T A 15: 10,595,089 (GRCm39) I145L possibly damaging Het
Rasgrf1 A G 9: 89,884,414 (GRCm39) T960A possibly damaging Het
Rfx1 A T 8: 84,821,455 (GRCm39) I755F probably damaging Het
Rims1 T G 1: 22,503,174 (GRCm39) L670F probably damaging Het
Rtkn G A 6: 83,126,692 (GRCm39) C297Y probably damaging Het
Sec23a A T 12: 59,036,229 (GRCm39) N378K probably benign Het
Slc1a2 T C 2: 102,597,340 (GRCm39) M449T probably damaging Het
Slc22a3 G A 17: 12,652,518 (GRCm39) L369F possibly damaging Het
Slc34a1 A G 13: 24,006,390 (GRCm39) E472G probably benign Het
Slc49a4 G T 16: 35,555,947 (GRCm39) T171K probably benign Het
Smad6 G T 9: 63,929,069 (GRCm39) D82E unknown Het
Smgc A T 15: 91,736,811 (GRCm39) I463F possibly damaging Het
Strada C A 11: 106,061,865 (GRCm39) G166C probably damaging Het
Tet2 C T 3: 133,175,352 (GRCm39) E1332K possibly damaging Het
Tfcp2l1 A G 1: 118,596,362 (GRCm39) N366D probably damaging Het
Tll2 G A 19: 41,105,723 (GRCm39) P369L possibly damaging Het
Tox4 T C 14: 52,529,554 (GRCm39) V505A probably benign Het
Trbv4 A G 6: 41,036,787 (GRCm39) D104G probably damaging Het
Ugdh T C 5: 65,574,380 (GRCm39) E416G probably damaging Het
Usp47 T A 7: 111,686,220 (GRCm39) C613S probably damaging Het
Vmn1r11 T A 6: 57,115,147 (GRCm39) N270K probably benign Het
Wsb2 T A 5: 117,509,160 (GRCm39) L147Q probably damaging Het
Xrn1 G A 9: 95,861,198 (GRCm39) A453T possibly damaging Het
Zan A G 5: 137,460,106 (GRCm39) S1262P unknown Het
Zswim4 A G 8: 84,946,556 (GRCm39) L700P probably damaging Het
Other mutations in Tcaf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Tcaf3 APN 6 42,570,319 (GRCm39) missense probably benign 0.14
IGL00931:Tcaf3 APN 6 42,574,162 (GRCm39) missense probably benign 0.16
IGL01391:Tcaf3 APN 6 42,570,615 (GRCm39) missense probably damaging 1.00
IGL01804:Tcaf3 APN 6 42,574,063 (GRCm39) missense probably damaging 1.00
IGL02272:Tcaf3 APN 6 42,573,594 (GRCm39) missense probably damaging 0.98
IGL02934:Tcaf3 APN 6 42,570,832 (GRCm39) missense probably benign 0.00
IGL03258:Tcaf3 APN 6 42,566,773 (GRCm39) missense probably damaging 1.00
defused UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R0116:Tcaf3 UTSW 6 42,568,284 (GRCm39) missense probably benign 0.12
R0135:Tcaf3 UTSW 6 42,566,692 (GRCm39) missense probably benign
R0357:Tcaf3 UTSW 6 42,566,761 (GRCm39) missense probably damaging 0.98
R0526:Tcaf3 UTSW 6 42,566,738 (GRCm39) missense probably damaging 1.00
R0592:Tcaf3 UTSW 6 42,573,777 (GRCm39) missense probably benign 0.16
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1902:Tcaf3 UTSW 6 42,570,486 (GRCm39) missense possibly damaging 0.83
R1912:Tcaf3 UTSW 6 42,573,622 (GRCm39) missense possibly damaging 0.59
R2020:Tcaf3 UTSW 6 42,570,658 (GRCm39) missense possibly damaging 0.66
R2238:Tcaf3 UTSW 6 42,570,262 (GRCm39) missense probably benign 0.00
R2259:Tcaf3 UTSW 6 42,568,364 (GRCm39) missense possibly damaging 0.53
R2436:Tcaf3 UTSW 6 42,570,663 (GRCm39) missense probably damaging 1.00
R3005:Tcaf3 UTSW 6 42,570,978 (GRCm39) missense probably damaging 1.00
R3402:Tcaf3 UTSW 6 42,570,787 (GRCm39) missense probably benign 0.08
R3753:Tcaf3 UTSW 6 42,566,738 (GRCm39) missense probably damaging 1.00
R3799:Tcaf3 UTSW 6 42,574,014 (GRCm39) missense probably damaging 1.00
R4515:Tcaf3 UTSW 6 42,566,930 (GRCm39) missense probably damaging 1.00
R4640:Tcaf3 UTSW 6 42,564,513 (GRCm39) missense probably damaging 0.96
R4688:Tcaf3 UTSW 6 42,570,300 (GRCm39) splice site probably null
R4904:Tcaf3 UTSW 6 42,570,931 (GRCm39) nonsense probably null
R5030:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5031:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5045:Tcaf3 UTSW 6 42,570,618 (GRCm39) missense possibly damaging 0.55
R5105:Tcaf3 UTSW 6 42,568,259 (GRCm39) missense probably damaging 1.00
R5139:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5187:Tcaf3 UTSW 6 42,573,954 (GRCm39) missense possibly damaging 0.51
R5196:Tcaf3 UTSW 6 42,570,649 (GRCm39) missense probably benign 0.00
R5213:Tcaf3 UTSW 6 42,568,401 (GRCm39) missense probably damaging 1.00
R5296:Tcaf3 UTSW 6 42,564,444 (GRCm39) missense possibly damaging 0.55
R5402:Tcaf3 UTSW 6 42,568,860 (GRCm39) missense probably benign 0.12
R5425:Tcaf3 UTSW 6 42,573,697 (GRCm39) missense probably damaging 1.00
R5431:Tcaf3 UTSW 6 42,574,119 (GRCm39) missense probably damaging 1.00
R5601:Tcaf3 UTSW 6 42,564,462 (GRCm39) missense possibly damaging 0.90
R5839:Tcaf3 UTSW 6 42,570,783 (GRCm39) missense possibly damaging 0.55
R5865:Tcaf3 UTSW 6 42,573,631 (GRCm39) missense probably benign 0.07
R6005:Tcaf3 UTSW 6 42,566,905 (GRCm39) missense probably benign 0.19
R6270:Tcaf3 UTSW 6 42,570,725 (GRCm39) missense probably benign 0.00
R6341:Tcaf3 UTSW 6 42,574,193 (GRCm39) missense possibly damaging 0.55
R6344:Tcaf3 UTSW 6 42,574,105 (GRCm39) missense possibly damaging 0.48
R6521:Tcaf3 UTSW 6 42,570,172 (GRCm39) missense probably damaging 0.99
R6589:Tcaf3 UTSW 6 42,570,995 (GRCm39) missense possibly damaging 0.55
R6981:Tcaf3 UTSW 6 42,574,059 (GRCm39) missense probably damaging 1.00
R7185:Tcaf3 UTSW 6 42,570,864 (GRCm39) missense probably benign 0.01
R7262:Tcaf3 UTSW 6 42,570,735 (GRCm39) missense probably damaging 0.97
R7340:Tcaf3 UTSW 6 42,566,848 (GRCm39) missense probably benign 0.08
R7421:Tcaf3 UTSW 6 42,573,776 (GRCm39) missense probably benign 0.02
R7690:Tcaf3 UTSW 6 42,574,069 (GRCm39) missense probably damaging 1.00
R7850:Tcaf3 UTSW 6 42,571,140 (GRCm39) splice site probably null
R7909:Tcaf3 UTSW 6 42,568,898 (GRCm39) missense possibly damaging 0.92
R9419:Tcaf3 UTSW 6 42,573,716 (GRCm39) missense probably benign 0.00
R9440:Tcaf3 UTSW 6 42,573,906 (GRCm39) nonsense probably null
R9469:Tcaf3 UTSW 6 42,573,828 (GRCm39) missense probably benign 0.00
R9668:Tcaf3 UTSW 6 42,566,636 (GRCm39) missense probably damaging 1.00
R9787:Tcaf3 UTSW 6 42,574,024 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCGCTTAAGGACGATGTTATCTG -3'
(R):5'- GGCATTTCCCTTGGGAGTAG -3'

Sequencing Primer
(F):5'- ACAGCTAGAGTATGGATTCCTGC -3'
(R):5'- TCCCTTGGGAGTAGACAATTCAC -3'
Posted On 2019-06-26