Incidental Mutation 'R7155:Colgalt1'
ID 557219
Institutional Source Beutler Lab
Gene Symbol Colgalt1
Ensembl Gene ENSMUSG00000034807
Gene Name collagen beta(1-O)galactosyltransferase 1
Synonyms Glt25d1, 2810024B22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock # R7155 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 71610998-71624911 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 71623710 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 602 (S602P)
Ref Sequence ENSEMBL: ENSMUSP00000047923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030170] [ENSMUST00000047903]
AlphaFold Q8K297
Predicted Effect probably benign
Transcript: ENSMUST00000030170
SMART Domains Protein: ENSMUSP00000030170
Gene: ENSMUSG00000034799

DomainStartEndE-ValueType
C2 3 94 5.23e-10 SMART
low complexity region 187 202 N/A INTRINSIC
low complexity region 264 277 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
coiled coil region 321 359 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 435 450 N/A INTRINSIC
PDB:2KDU|B 454 488 3e-16 PDB
C1 563 612 3.93e-18 SMART
C2 686 793 5.86e-22 SMART
DUF1041 1002 1111 1.6e-56 SMART
Pfam:Membr_traf_MHD 1355 1520 6.3e-53 PFAM
C2 1555 1661 5.03e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000047903
AA Change: S602P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047923
Gene: ENSMUSG00000034807
AA Change: S602P

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:Glyco_tranf_2_4 56 176 4.6e-22 PFAM
Pfam:Glyco_transf_25 335 520 8.8e-37 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of two enzymes that transfers galactose moieties to hydroxylysine residues of collagen and mannose binding lectin. This gene is constitutively expressed and encodes a soluble protein that localizes to the endoplasmic reticulum. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,473,569 L63P possibly damaging Het
Abca13 A T 11: 9,529,010 Y4286F probably benign Het
Aldh5a1 A C 13: 24,911,589 V515G possibly damaging Het
Ankrd42 T C 7: 92,591,933 E406G possibly damaging Het
Arfgef2 T A 2: 166,865,813 M1043K probably benign Het
Arhgef11 T A 3: 87,709,572 Y383* probably null Het
Aste1 C T 9: 105,405,136 P614L probably damaging Het
B3galt5 T A 16: 96,315,805 S213T probably damaging Het
Bak1 A G 17: 27,022,460 L108P possibly damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Bdp1 T G 13: 100,061,151 T909P possibly damaging Het
Cacna1i A G 15: 80,395,238 H2060R probably benign Het
Cdhr3 G T 12: 33,061,773 P246Q probably damaging Het
Csde1 T C 3: 103,039,953 S74P probably damaging Het
Cyp51 A T 5: 4,087,846 C366S possibly damaging Het
Dcaf7 A G 11: 106,037,190 N23D probably damaging Het
Ddx10 G A 9: 53,117,288 A772V probably benign Het
Ddx4 A G 13: 112,613,785 F404S probably benign Het
Dirc2 G T 16: 35,735,577 T171K probably benign Het
Dlg4 T A 11: 70,017,216 M1K probably null Het
Dnajc6 T C 4: 101,612,945 V293A probably damaging Het
Etl4 G T 2: 20,806,931 R1643L probably damaging Het
F13b G A 1: 139,508,157 E234K probably damaging Het
Fam171a1 T C 2: 3,225,729 I633T probably benign Het
Frem3 A G 8: 80,616,039 I1654V probably benign Het
Galr2 A G 11: 116,283,582 E346G possibly damaging Het
Gck G A 11: 5,949,705 probably benign Het
Gen1 G T 12: 11,241,832 T717K probably benign Het
Gm13083 A T 4: 143,616,165 I281F probably benign Het
Gpatch8 TTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC 11: 102,480,188 probably benign Het
Hat1 A G 2: 71,421,251 T215A possibly damaging Het
Hmbox1 A T 14: 64,897,037 M38K probably damaging Het
Ifi47 A G 11: 49,096,542 K379E probably benign Het
Ift81 T C 5: 122,568,999 Y460C probably damaging Het
Jarid2 T A 13: 44,902,462 S381R probably damaging Het
Kmt2b A T 7: 30,579,963 V1458E probably damaging Het
Kpna4 G T 3: 69,089,933 P336Q probably damaging Het
Krt84 T C 15: 101,532,254 R168G probably damaging Het
Lhx8 T A 3: 154,324,584 Y137F possibly damaging Het
Lin7b T C 7: 45,370,227 E19G probably damaging Het
Lrmda A T 14: 22,584,540 R131S probably damaging Het
Lrrc75b C T 10: 75,553,678 A280T possibly damaging Het
Megf11 G A 9: 64,647,951 R268K probably null Het
Mgat4e G T 1: 134,541,959 Q116K probably damaging Het
Mlkl A G 8: 111,319,403 L325P probably damaging Het
Mup2 A G 4: 60,137,641 L134P probably damaging Het
Myo19 A G 11: 84,900,586 E489G probably damaging Het
Ncbp3 C A 11: 73,048,009 P37Q probably damaging Het
Nf2 A G 11: 4,799,964 V236A probably damaging Het
Nlrp1a A T 11: 71,124,079 M115K possibly damaging Het
Nsf T A 11: 103,828,530 K649* probably null Het
Olfml2b A T 1: 170,666,785 I313L probably benign Het
Olfr316 T A 11: 58,758,283 I206N probably damaging Het
Olfr654 T A 7: 104,588,557 V251D possibly damaging Het
Papln T A 12: 83,776,521 L444Q probably damaging Het
Phc3 T C 3: 30,914,197 I897V probably benign Het
Plcg1 T C 2: 160,754,380 L632P probably damaging Het
Prkg1 T C 19: 31,302,301 T178A probably damaging Het
Ptges T A 2: 30,892,804 T79S probably benign Het
Rab26 T C 17: 24,532,289 T81A probably damaging Het
Rai14 T A 15: 10,595,003 I145L possibly damaging Het
Rasgrf1 A G 9: 90,002,361 T960A possibly damaging Het
Rfx1 A T 8: 84,094,826 I755F probably damaging Het
Rims1 T G 1: 22,432,923 L670F probably damaging Het
Rtkn G A 6: 83,149,711 C297Y probably damaging Het
Sec23a A T 12: 58,989,443 N378K probably benign Het
Slc17a2 A G 13: 23,822,407 E472G probably benign Het
Slc1a2 T C 2: 102,766,995 M449T probably damaging Het
Slc22a3 G A 17: 12,433,631 L369F possibly damaging Het
Smad6 G T 9: 64,021,787 D82E unknown Het
Smgc A T 15: 91,852,608 I463F possibly damaging Het
Strada C A 11: 106,171,039 G166C probably damaging Het
Tcaf3 A G 6: 42,593,891 V309A probably benign Het
Tet2 C T 3: 133,469,591 E1332K possibly damaging Het
Tfcp2l1 A G 1: 118,668,632 N366D probably damaging Het
Tll2 G A 19: 41,117,284 P369L possibly damaging Het
Tox4 T C 14: 52,292,097 V505A probably benign Het
Trbv4 A G 6: 41,059,853 D104G probably damaging Het
Ugdh T C 5: 65,417,037 E416G probably damaging Het
Usp47 T A 7: 112,087,013 C613S probably damaging Het
Vmn1r11 T A 6: 57,138,162 N270K probably benign Het
Wsb2 T A 5: 117,371,095 L147Q probably damaging Het
Xrn1 G A 9: 95,979,145 A453T possibly damaging Het
Zan A G 5: 137,461,844 S1262P unknown Het
Zswim4 A G 8: 84,219,927 L700P probably damaging Het
Other mutations in Colgalt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Colgalt1 APN 8 71622776 missense probably damaging 1.00
IGL01888:Colgalt1 APN 8 71617674 missense probably damaging 1.00
IGL03191:Colgalt1 APN 8 71623087 splice site probably null
P0041:Colgalt1 UTSW 8 71622790 missense probably benign 0.05
R0094:Colgalt1 UTSW 8 71623158 missense probably damaging 1.00
R0094:Colgalt1 UTSW 8 71623158 missense probably damaging 1.00
R1342:Colgalt1 UTSW 8 71618160 missense probably damaging 1.00
R1642:Colgalt1 UTSW 8 71620757 missense probably benign 0.01
R1754:Colgalt1 UTSW 8 71623179 missense probably damaging 1.00
R1830:Colgalt1 UTSW 8 71623137 missense probably damaging 0.99
R1844:Colgalt1 UTSW 8 71611351 missense possibly damaging 0.84
R2050:Colgalt1 UTSW 8 71617686 critical splice donor site probably null
R2393:Colgalt1 UTSW 8 71623741 missense probably benign 0.00
R2406:Colgalt1 UTSW 8 71617668 missense probably damaging 1.00
R3897:Colgalt1 UTSW 8 71619662 missense probably damaging 1.00
R4210:Colgalt1 UTSW 8 71622706 missense probably benign 0.34
R4909:Colgalt1 UTSW 8 71620633 missense possibly damaging 0.80
R5428:Colgalt1 UTSW 8 71622776 missense probably damaging 1.00
R5995:Colgalt1 UTSW 8 71623110 missense probably damaging 1.00
R6170:Colgalt1 UTSW 8 71621870 missense probably damaging 1.00
R6994:Colgalt1 UTSW 8 71623521 missense probably damaging 1.00
R6995:Colgalt1 UTSW 8 71623521 missense probably damaging 1.00
R7691:Colgalt1 UTSW 8 71620754 missense probably benign 0.00
R7877:Colgalt1 UTSW 8 71621864 missense probably damaging 1.00
R8899:Colgalt1 UTSW 8 71623662 missense probably damaging 1.00
X0066:Colgalt1 UTSW 8 71623596 missense probably damaging 1.00
Z1177:Colgalt1 UTSW 8 71623208 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTATCTCCCATAGGTCAGAATAC -3'
(R):5'- ACATGGAGACCTCTGTGCTTG -3'

Sequencing Primer
(F):5'- GGTCAGAATACAAGAGTCACTTCTC -3'
(R):5'- CATGGAGACCTCTGTGCTTGTAGAG -3'
Posted On 2019-06-26