Mutagenetix > Incidental Mutation

Incidental Mutation 'R7155:Frem3'

557220

Institutional Source

Beutler Lab

Gene Symbol

Frem3

Ensembl Gene

ENSMUSG00000042353

Gene Name

Fras1 related extracellular matrix protein 3

Synonyms

LOC333315

MMRRC Submission

045226-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.141) question?

Stock #

R7155 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

80611080-80695356 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80616039 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1654 (I1654V)

Ref Sequence

ENSEMBL: ENSMUSP00000038015 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039695]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000039695
AA Change: I1654V

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000038015
Gene: ENSMUSG00000042353
AA Change: I1654V

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:Cadherin_3	369	515	9.5e-31	PFAM
Pfam:Cadherin_3	495	596	9.4e-20	PFAM
Pfam:Cadherin_3	637	786	4.2e-20	PFAM
Pfam:Cadherin_3	788	913	5.5e-23	PFAM
Pfam:Cadherin_3	998	1163	1.8e-20	PFAM
Pfam:Cadherin_3	1129	1254	1.3e-19	PFAM
Pfam:Cadherin_3	1250	1395	9.5e-34	PFAM
Pfam:Cadherin_3	1397	1508	2.7e-21	PFAM
Pfam:Cadherin_3	1493	1617	1.2e-27	PFAM
Pfam:Cadherin_3	1622	1748	4.8e-17	PFAM
Calx_beta	1754	1853	1.45e-7	SMART
Calx_beta	1866	1977	3.35e-12	SMART
Calx_beta	1991	2098	1.61e-5	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The protein belongs to the family of FRAS1/FREM extracellular matrix proteins and may play a role cell adhesion. [provided by RefSeq, Feb 2017]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	A	G	2: 151,473,569	L63P	possibly damaging	Het
Abca13	A	T	11: 9,529,010	Y4286F	probably benign	Het
Aldh5a1	A	C	13: 24,911,589	V515G	possibly damaging	Het
Ankrd42	T	C	7: 92,591,933	E406G	possibly damaging	Het
Arfgef2	T	A	2: 166,865,813	M1043K	probably benign	Het
Arhgef11	T	A	3: 87,709,572	Y383*	probably null	Het
Aste1	C	T	9: 105,405,136	P614L	probably damaging	Het
B3galt5	T	A	16: 96,315,805	S213T	probably damaging	Het
Bak1	A	G	17: 27,022,460	L108P	possibly damaging	Het
Bcl6	G	A	16: 23,966,226	R675*	probably null	Het
Bdp1	T	G	13: 100,061,151	T909P	possibly damaging	Het
Cacna1i	A	G	15: 80,395,238	H2060R	probably benign	Het
Cdhr3	G	T	12: 33,061,773	P246Q	probably damaging	Het
Colgalt1	T	C	8: 71,623,710	S602P	probably damaging	Het
Csde1	T	C	3: 103,039,953	S74P	probably damaging	Het
Cyp51	A	T	5: 4,087,846	C366S	possibly damaging	Het
Dcaf7	A	G	11: 106,037,190	N23D	probably damaging	Het
Ddx10	G	A	9: 53,117,288	A772V	probably benign	Het
Ddx4	A	G	13: 112,613,785	F404S	probably benign	Het
Dirc2	G	T	16: 35,735,577	T171K	probably benign	Het
Dlg4	T	A	11: 70,017,216	M1K	probably null	Het
Dnajc6	T	C	4: 101,612,945	V293A	probably damaging	Het
Etl4	G	T	2: 20,806,931	R1643L	probably damaging	Het
F13b	G	A	1: 139,508,157	E234K	probably damaging	Het
Fam171a1	T	C	2: 3,225,729	I633T	probably benign	Het
Galr2	A	G	11: 116,283,582	E346G	possibly damaging	Het
Gck	G	A	11: 5,949,705		probably benign	Het
Gen1	G	T	12: 11,241,832	T717K	probably benign	Het
Gm13083	A	T	4: 143,616,165	I281F	probably benign	Het
Gpatch8	TTCCTCCTCCTCCTCTTCCTCCTCCTC	TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC	11: 102,480,188		probably benign	Het
Hat1	A	G	2: 71,421,251	T215A	possibly damaging	Het
Hmbox1	A	T	14: 64,897,037	M38K	probably damaging	Het
Ifi47	A	G	11: 49,096,542	K379E	probably benign	Het
Ift81	T	C	5: 122,568,999	Y460C	probably damaging	Het
Jarid2	T	A	13: 44,902,462	S381R	probably damaging	Het
Kmt2b	A	T	7: 30,579,963	V1458E	probably damaging	Het
Kpna4	G	T	3: 69,089,933	P336Q	probably damaging	Het
Krt84	T	C	15: 101,532,254	R168G	probably damaging	Het
Lhx8	T	A	3: 154,324,584	Y137F	possibly damaging	Het
Lin7b	T	C	7: 45,370,227	E19G	probably damaging	Het
Lrmda	A	T	14: 22,584,540	R131S	probably damaging	Het
Lrrc75b	C	T	10: 75,553,678	A280T	possibly damaging	Het
Megf11	G	A	9: 64,647,951	R268K	probably null	Het
Mgat4e	G	T	1: 134,541,959	Q116K	probably damaging	Het
Mlkl	A	G	8: 111,319,403	L325P	probably damaging	Het
Mup2	A	G	4: 60,137,641	L134P	probably damaging	Het
Myo19	A	G	11: 84,900,586	E489G	probably damaging	Het
Ncbp3	C	A	11: 73,048,009	P37Q	probably damaging	Het
Nf2	A	G	11: 4,799,964	V236A	probably damaging	Het
Nlrp1a	A	T	11: 71,124,079	M115K	possibly damaging	Het
Nsf	T	A	11: 103,828,530	K649*	probably null	Het
Olfml2b	A	T	1: 170,666,785	I313L	probably benign	Het
Olfr316	T	A	11: 58,758,283	I206N	probably damaging	Het
Olfr654	T	A	7: 104,588,557	V251D	possibly damaging	Het
Papln	T	A	12: 83,776,521	L444Q	probably damaging	Het
Phc3	T	C	3: 30,914,197	I897V	probably benign	Het
Plcg1	T	C	2: 160,754,380	L632P	probably damaging	Het
Prkg1	T	C	19: 31,302,301	T178A	probably damaging	Het
Ptges	T	A	2: 30,892,804	T79S	probably benign	Het
Rab26	T	C	17: 24,532,289	T81A	probably damaging	Het
Rai14	T	A	15: 10,595,003	I145L	possibly damaging	Het
Rasgrf1	A	G	9: 90,002,361	T960A	possibly damaging	Het
Rfx1	A	T	8: 84,094,826	I755F	probably damaging	Het
Rims1	T	G	1: 22,432,923	L670F	probably damaging	Het
Rtkn	G	A	6: 83,149,711	C297Y	probably damaging	Het
Sec23a	A	T	12: 58,989,443	N378K	probably benign	Het
Slc17a2	A	G	13: 23,822,407	E472G	probably benign	Het
Slc1a2	T	C	2: 102,766,995	M449T	probably damaging	Het
Slc22a3	G	A	17: 12,433,631	L369F	possibly damaging	Het
Smad6	G	T	9: 64,021,787	D82E	unknown	Het
Smgc	A	T	15: 91,852,608	I463F	possibly damaging	Het
Strada	C	A	11: 106,171,039	G166C	probably damaging	Het
Tcaf3	A	G	6: 42,593,891	V309A	probably benign	Het
Tet2	C	T	3: 133,469,591	E1332K	possibly damaging	Het
Tfcp2l1	A	G	1: 118,668,632	N366D	probably damaging	Het
Tll2	G	A	19: 41,117,284	P369L	possibly damaging	Het
Tox4	T	C	14: 52,292,097	V505A	probably benign	Het
Trbv4	A	G	6: 41,059,853	D104G	probably damaging	Het
Ugdh	T	C	5: 65,417,037	E416G	probably damaging	Het
Usp47	T	A	7: 112,087,013	C613S	probably damaging	Het
Vmn1r11	T	A	6: 57,138,162	N270K	probably benign	Het
Wsb2	T	A	5: 117,371,095	L147Q	probably damaging	Het
Xrn1	G	A	9: 95,979,145	A453T	possibly damaging	Het
Zan	A	G	5: 137,461,844	S1262P	unknown	Het
Zswim4	A	G	8: 84,219,927	L700P	probably damaging	Het

Other mutations in Frem3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Frem3	APN	8	80668810	missense	possibly damaging	0.75
IGL01019:Frem3	APN	8	80615134	missense	probably benign	0.02
IGL01470:Frem3	APN	8	80614315	missense	probably damaging	1.00
IGL01609:Frem3	APN	8	80612704	missense	probably benign	0.00
IGL01622:Frem3	APN	8	80613915	missense	probably benign	0.01
IGL01623:Frem3	APN	8	80613915	missense	probably benign	0.01
IGL01751:Frem3	APN	8	80615743	missense	probably benign	0.33
IGL02037:Frem3	APN	8	80611489	missense	probably benign	0.31
IGL02039:Frem3	APN	8	80612971	missense	probably damaging	1.00
IGL02084:Frem3	APN	8	80612443	missense	possibly damaging	0.95
IGL02124:Frem3	APN	8	80613094	missense	probably damaging	0.99
IGL02140:Frem3	APN	8	80614107	missense	possibly damaging	0.84
IGL02836:Frem3	APN	8	80614381	missense	probably benign
IGL03090:Frem3	APN	8	80618229	missense	probably benign	0.01
IGL03102:Frem3	APN	8	80613032	missense	possibly damaging	0.92
IGL03116:Frem3	APN	8	80612806	missense	possibly damaging	0.84
IGL03165:Frem3	APN	8	80612529	missense	probably benign	0.26
IGL03224:Frem3	APN	8	80613463	missense	probably damaging	1.00
IGL03401:Frem3	APN	8	80614541	missense	probably damaging	1.00
IGL03403:Frem3	APN	8	80611090	missense	probably benign	0.04
FR4340:Frem3	UTSW	8	80615241	small insertion	probably benign
FR4976:Frem3	UTSW	8	80615241	small insertion	probably benign
IGL02991:Frem3	UTSW	8	80668882	missense	probably damaging	1.00
IGL03052:Frem3	UTSW	8	80614530	missense	probably damaging	1.00
R0089:Frem3	UTSW	8	80615878	missense	possibly damaging	0.94
R0647:Frem3	UTSW	8	80615185	missense	probably damaging	1.00
R0690:Frem3	UTSW	8	80613952	missense	possibly damaging	0.84
R0766:Frem3	UTSW	8	80615322	missense	probably benign
R0834:Frem3	UTSW	8	80687008	missense	probably damaging	1.00
R0909:Frem3	UTSW	8	80663406	missense	probably benign	0.45
R1033:Frem3	UTSW	8	80695157	missense	probably benign	0.00
R1144:Frem3	UTSW	8	80611884	missense	probably benign	0.01
R1312:Frem3	UTSW	8	80615322	missense	probably benign
R1330:Frem3	UTSW	8	80668839	missense	probably damaging	0.99
R1355:Frem3	UTSW	8	80690702	missense	probably damaging	1.00
R1390:Frem3	UTSW	8	80690773	missense	probably damaging	0.99
R1413:Frem3	UTSW	8	80668801	missense	probably benign
R1470:Frem3	UTSW	8	80611191	missense	probably benign	0.05
R1470:Frem3	UTSW	8	80611191	missense	probably benign	0.05
R1503:Frem3	UTSW	8	80687018	missense	probably damaging	0.99
R1538:Frem3	UTSW	8	80612710	missense	probably damaging	1.00
R1538:Frem3	UTSW	8	80613135	missense	probably benign	0.00
R1612:Frem3	UTSW	8	80614861	missense	probably damaging	1.00
R1793:Frem3	UTSW	8	80613112	missense	probably benign	0.03
R1872:Frem3	UTSW	8	80612576	missense	probably damaging	1.00
R1879:Frem3	UTSW	8	80611938	nonsense	probably null
R1886:Frem3	UTSW	8	80613885	missense	probably benign	0.00
R1933:Frem3	UTSW	8	80612890	missense	probably benign	0.00
R2027:Frem3	UTSW	8	80695337	missense	possibly damaging	0.75
R2040:Frem3	UTSW	8	80615826	missense	possibly damaging	0.92
R2050:Frem3	UTSW	8	80614891	missense	probably damaging	1.00
R2079:Frem3	UTSW	8	80615103	missense	probably benign	0.03
R2099:Frem3	UTSW	8	80615859	missense	probably benign	0.06
R2120:Frem3	UTSW	8	80615457	missense	probably benign	0.20
R2842:Frem3	UTSW	8	80669349	splice site	probably null
R2845:Frem3	UTSW	8	80613220	missense	probably damaging	1.00
R3015:Frem3	UTSW	8	80690773	missense	probably damaging	0.99
R3442:Frem3	UTSW	8	80613040	missense	probably damaging	1.00
R3724:Frem3	UTSW	8	80615271	missense	probably benign	0.06
R3730:Frem3	UTSW	8	80615916	missense	probably damaging	0.99
R3939:Frem3	UTSW	8	80615020	missense	possibly damaging	0.84
R3940:Frem3	UTSW	8	80615020	missense	possibly damaging	0.84
R3941:Frem3	UTSW	8	80615020	missense	possibly damaging	0.84
R4089:Frem3	UTSW	8	80615173	missense	probably damaging	1.00
R4282:Frem3	UTSW	8	80614141	missense	probably benign	0.00
R4437:Frem3	UTSW	8	80612607	missense	probably benign	0.30
R4480:Frem3	UTSW	8	80611357	missense	probably benign	0.10
R4575:Frem3	UTSW	8	80616075	missense	probably benign	0.17
R4583:Frem3	UTSW	8	80613514	missense	probably benign	0.03
R4620:Frem3	UTSW	8	80668957	missense	possibly damaging	0.82
R4621:Frem3	UTSW	8	80669191	splice site	probably null
R4644:Frem3	UTSW	8	80613727	missense	probably benign	0.33
R4667:Frem3	UTSW	8	80663420	missense	probably damaging	0.97
R4748:Frem3	UTSW	8	80611459	missense	probably damaging	1.00
R4823:Frem3	UTSW	8	80613958	missense	probably benign	0.25
R4836:Frem3	UTSW	8	80663397	missense	probably damaging	0.99
R4867:Frem3	UTSW	8	80613283	missense	probably damaging	1.00
R4921:Frem3	UTSW	8	80613136	missense	possibly damaging	0.83
R5030:Frem3	UTSW	8	80613247	missense	possibly damaging	0.89
R5035:Frem3	UTSW	8	80615914	missense	probably damaging	0.97
R5172:Frem3	UTSW	8	80612566	missense	probably benign	0.44
R5289:Frem3	UTSW	8	80612319	missense	probably benign	0.00
R5492:Frem3	UTSW	8	80612677	missense	probably damaging	1.00
R5655:Frem3	UTSW	8	80612694	missense	probably benign	0.00
R5685:Frem3	UTSW	8	80695303	missense	probably damaging	1.00
R5723:Frem3	UTSW	8	80613397	missense	probably benign	0.02
R5743:Frem3	UTSW	8	80615778	missense	probably damaging	0.98
R5889:Frem3	UTSW	8	80614288	missense	probably damaging	1.00
R6048:Frem3	UTSW	8	80613433	missense	probably benign	0.03
R6057:Frem3	UTSW	8	80615587	missense	probably damaging	0.99
R6137:Frem3	UTSW	8	80615047	missense	probably benign
R6264:Frem3	UTSW	8	80615203	missense	probably damaging	1.00
R6339:Frem3	UTSW	8	80613015	missense	possibly damaging	0.84
R6418:Frem3	UTSW	8	80611152	missense	probably benign	0.08
R6680:Frem3	UTSW	8	80669320	missense	probably damaging	1.00
R6773:Frem3	UTSW	8	80611815	missense	probably damaging	1.00
R6838:Frem3	UTSW	8	80612031	missense	probably damaging	1.00
R6928:Frem3	UTSW	8	80611282	missense	possibly damaging	0.48
R6939:Frem3	UTSW	8	80615145	missense	probably benign	0.23
R6995:Frem3	UTSW	8	80612579	missense	probably damaging	0.98
R7112:Frem3	UTSW	8	80612031	missense	probably damaging	1.00
R7235:Frem3	UTSW	8	80690725	missense	probably benign	0.00
R7282:Frem3	UTSW	8	80612031	missense	probably damaging	1.00
R7403:Frem3	UTSW	8	80616145	missense	probably damaging	1.00
R7422:Frem3	UTSW	8	80615763	missense	probably benign	0.00
R7485:Frem3	UTSW	8	80613336	missense	probably damaging	1.00
R7516:Frem3	UTSW	8	80612083	missense	probably damaging	0.99
R7858:Frem3	UTSW	8	80611721	nonsense	probably null
R7976:Frem3	UTSW	8	80611602	nonsense	probably null
R8171:Frem3	UTSW	8	80615240	missense	probably damaging	1.00
R8185:Frem3	UTSW	8	80612304	nonsense	probably null
R8306:Frem3	UTSW	8	80612211	missense	possibly damaging	0.95
R8478:Frem3	UTSW	8	80611558	missense	probably damaging	1.00
R8518:Frem3	UTSW	8	80612595	missense	probably damaging	1.00
R8794:Frem3	UTSW	8	80612278	missense	probably damaging	1.00
R8794:Frem3	UTSW	8	80616222	missense	probably benign	0.02
R8806:Frem3	UTSW	8	80663435	missense	probably benign	0.30
R8833:Frem3	UTSW	8	80612772	missense	probably benign	0.29
R8879:Frem3	UTSW	8	80613148	missense	probably damaging	0.98
R8897:Frem3	UTSW	8	80612790	missense	probably damaging	1.00
R8983:Frem3	UTSW	8	80669246	missense	probably damaging	1.00
R9207:Frem3	UTSW	8	80613442	missense	possibly damaging	0.73
R9277:Frem3	UTSW	8	80690773	missense	probably damaging	0.96
R9536:Frem3	UTSW	8	80615419	missense	probably benign	0.00
R9596:Frem3	UTSW	8	80615322	missense	probably benign
R9649:Frem3	UTSW	8	80614516	missense	probably damaging	1.00
R9671:Frem3	UTSW	8	80612505	missense	probably benign	0.00
R9723:Frem3	UTSW	8	80614723	missense	probably benign
R9790:Frem3	UTSW	8	80613261	missense	probably benign	0.01
R9791:Frem3	UTSW	8	80613261	missense	probably benign	0.01
RF030:Frem3	UTSW	8	80615238	small insertion	probably benign
RF034:Frem3	UTSW	8	80615238	small insertion	probably benign
RF042:Frem3	UTSW	8	80615238	small insertion	probably benign
X0024:Frem3	UTSW	8	80613081	missense	possibly damaging	0.76
X0027:Frem3	UTSW	8	80612388	nonsense	probably null
Z1088:Frem3	UTSW	8	80615426	missense	probably benign	0.04
Z1176:Frem3	UTSW	8	80611503	missense	probably damaging	0.99
Z1176:Frem3	UTSW	8	80615431	missense	probably benign	0.03
Z1177:Frem3	UTSW	8	80616129	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- TAATGGTAGCCGTCCTGTGACC -3'
(R):5'- ATTTCCAAGGCCAGCATTGAC -3'

Sequencing Primer
(F):5'- AAGAGCCTGATTCTCTATTGTCACG -3'
(R):5'- CATTGACGATGTAGCCATGC -3'

Posted On

2019-06-26