Incidental Mutation 'R7155:Zswim4'
ID 557222
Institutional Source Beutler Lab
Gene Symbol Zswim4
Ensembl Gene ENSMUSG00000035671
Gene Name zinc finger SWIM-type containing 4
Synonyms E130119J17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock # R7155 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 84210678-84237055 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84219927 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 700 (L700P)
Ref Sequence ENSEMBL: ENSMUSP00000040078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039480]
AlphaFold Q8C7B8
Predicted Effect probably damaging
Transcript: ENSMUST00000039480
AA Change: L700P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040078
Gene: ENSMUSG00000035671
AA Change: L700P

DomainStartEndE-ValueType
low complexity region 531 545 N/A INTRINSIC
low complexity region 576 588 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
low complexity region 672 683 N/A INTRINSIC
low complexity region 907 917 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,473,569 L63P possibly damaging Het
Abca13 A T 11: 9,529,010 Y4286F probably benign Het
Aldh5a1 A C 13: 24,911,589 V515G possibly damaging Het
Ankrd42 T C 7: 92,591,933 E406G possibly damaging Het
Arfgef2 T A 2: 166,865,813 M1043K probably benign Het
Arhgef11 T A 3: 87,709,572 Y383* probably null Het
Aste1 C T 9: 105,405,136 P614L probably damaging Het
B3galt5 T A 16: 96,315,805 S213T probably damaging Het
Bak1 A G 17: 27,022,460 L108P possibly damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Bdp1 T G 13: 100,061,151 T909P possibly damaging Het
Cacna1i A G 15: 80,395,238 H2060R probably benign Het
Cdhr3 G T 12: 33,061,773 P246Q probably damaging Het
Colgalt1 T C 8: 71,623,710 S602P probably damaging Het
Csde1 T C 3: 103,039,953 S74P probably damaging Het
Cyp51 A T 5: 4,087,846 C366S possibly damaging Het
Dcaf7 A G 11: 106,037,190 N23D probably damaging Het
Ddx10 G A 9: 53,117,288 A772V probably benign Het
Ddx4 A G 13: 112,613,785 F404S probably benign Het
Dirc2 G T 16: 35,735,577 T171K probably benign Het
Dlg4 T A 11: 70,017,216 M1K probably null Het
Dnajc6 T C 4: 101,612,945 V293A probably damaging Het
Etl4 G T 2: 20,806,931 R1643L probably damaging Het
F13b G A 1: 139,508,157 E234K probably damaging Het
Fam171a1 T C 2: 3,225,729 I633T probably benign Het
Frem3 A G 8: 80,616,039 I1654V probably benign Het
Galr2 A G 11: 116,283,582 E346G possibly damaging Het
Gck G A 11: 5,949,705 probably benign Het
Gen1 G T 12: 11,241,832 T717K probably benign Het
Gm13083 A T 4: 143,616,165 I281F probably benign Het
Gpatch8 TTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC 11: 102,480,188 probably benign Het
Hat1 A G 2: 71,421,251 T215A possibly damaging Het
Hmbox1 A T 14: 64,897,037 M38K probably damaging Het
Ifi47 A G 11: 49,096,542 K379E probably benign Het
Ift81 T C 5: 122,568,999 Y460C probably damaging Het
Jarid2 T A 13: 44,902,462 S381R probably damaging Het
Kmt2b A T 7: 30,579,963 V1458E probably damaging Het
Kpna4 G T 3: 69,089,933 P336Q probably damaging Het
Krt84 T C 15: 101,532,254 R168G probably damaging Het
Lhx8 T A 3: 154,324,584 Y137F possibly damaging Het
Lin7b T C 7: 45,370,227 E19G probably damaging Het
Lrmda A T 14: 22,584,540 R131S probably damaging Het
Lrrc75b C T 10: 75,553,678 A280T possibly damaging Het
Megf11 G A 9: 64,647,951 R268K probably null Het
Mgat4e G T 1: 134,541,959 Q116K probably damaging Het
Mlkl A G 8: 111,319,403 L325P probably damaging Het
Mup2 A G 4: 60,137,641 L134P probably damaging Het
Myo19 A G 11: 84,900,586 E489G probably damaging Het
Ncbp3 C A 11: 73,048,009 P37Q probably damaging Het
Nf2 A G 11: 4,799,964 V236A probably damaging Het
Nlrp1a A T 11: 71,124,079 M115K possibly damaging Het
Nsf T A 11: 103,828,530 K649* probably null Het
Olfml2b A T 1: 170,666,785 I313L probably benign Het
Olfr316 T A 11: 58,758,283 I206N probably damaging Het
Olfr654 T A 7: 104,588,557 V251D possibly damaging Het
Papln T A 12: 83,776,521 L444Q probably damaging Het
Phc3 T C 3: 30,914,197 I897V probably benign Het
Plcg1 T C 2: 160,754,380 L632P probably damaging Het
Prkg1 T C 19: 31,302,301 T178A probably damaging Het
Ptges T A 2: 30,892,804 T79S probably benign Het
Rab26 T C 17: 24,532,289 T81A probably damaging Het
Rai14 T A 15: 10,595,003 I145L possibly damaging Het
Rasgrf1 A G 9: 90,002,361 T960A possibly damaging Het
Rfx1 A T 8: 84,094,826 I755F probably damaging Het
Rims1 T G 1: 22,432,923 L670F probably damaging Het
Rtkn G A 6: 83,149,711 C297Y probably damaging Het
Sec23a A T 12: 58,989,443 N378K probably benign Het
Slc17a2 A G 13: 23,822,407 E472G probably benign Het
Slc1a2 T C 2: 102,766,995 M449T probably damaging Het
Slc22a3 G A 17: 12,433,631 L369F possibly damaging Het
Smad6 G T 9: 64,021,787 D82E unknown Het
Smgc A T 15: 91,852,608 I463F possibly damaging Het
Strada C A 11: 106,171,039 G166C probably damaging Het
Tcaf3 A G 6: 42,593,891 V309A probably benign Het
Tet2 C T 3: 133,469,591 E1332K possibly damaging Het
Tfcp2l1 A G 1: 118,668,632 N366D probably damaging Het
Tll2 G A 19: 41,117,284 P369L possibly damaging Het
Tox4 T C 14: 52,292,097 V505A probably benign Het
Trbv4 A G 6: 41,059,853 D104G probably damaging Het
Ugdh T C 5: 65,417,037 E416G probably damaging Het
Usp47 T A 7: 112,087,013 C613S probably damaging Het
Vmn1r11 T A 6: 57,138,162 N270K probably benign Het
Wsb2 T A 5: 117,371,095 L147Q probably damaging Het
Xrn1 G A 9: 95,979,145 A453T possibly damaging Het
Zan A G 5: 137,461,844 S1262P unknown Het
Other mutations in Zswim4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Zswim4 APN 8 84212140 missense probably damaging 1.00
IGL03048:Zswim4 UTSW 8 84211975 missense possibly damaging 0.95
R0217:Zswim4 UTSW 8 84212664 missense probably damaging 1.00
R0688:Zswim4 UTSW 8 84228888 missense possibly damaging 0.93
R1217:Zswim4 UTSW 8 84219972 missense possibly damaging 0.89
R1853:Zswim4 UTSW 8 84224200 missense probably damaging 1.00
R1878:Zswim4 UTSW 8 84212776 missense possibly damaging 0.55
R2205:Zswim4 UTSW 8 84225869 missense possibly damaging 0.70
R2940:Zswim4 UTSW 8 84223748 missense probably damaging 1.00
R3747:Zswim4 UTSW 8 84212047 missense possibly damaging 0.86
R3748:Zswim4 UTSW 8 84212047 missense possibly damaging 0.86
R3750:Zswim4 UTSW 8 84212047 missense possibly damaging 0.86
R4777:Zswim4 UTSW 8 84236957 missense probably benign
R4831:Zswim4 UTSW 8 84212319 missense probably damaging 1.00
R4959:Zswim4 UTSW 8 84212223 missense probably benign 0.22
R4968:Zswim4 UTSW 8 84217372 missense probably benign 0.37
R4973:Zswim4 UTSW 8 84212223 missense probably benign 0.22
R4977:Zswim4 UTSW 8 84226667 splice site probably null
R4978:Zswim4 UTSW 8 84226667 splice site probably null
R4980:Zswim4 UTSW 8 84226667 splice site probably null
R4981:Zswim4 UTSW 8 84226667 splice site probably null
R4982:Zswim4 UTSW 8 84226667 splice site probably null
R4983:Zswim4 UTSW 8 84226667 splice site probably null
R5248:Zswim4 UTSW 8 84219932 missense probably benign 0.13
R5337:Zswim4 UTSW 8 84235079 missense probably damaging 1.00
R5366:Zswim4 UTSW 8 84212790 missense probably benign 0.39
R5646:Zswim4 UTSW 8 84231110 splice site probably null
R5845:Zswim4 UTSW 8 84217242 splice site probably null
R6193:Zswim4 UTSW 8 84226145 missense probably benign
R6270:Zswim4 UTSW 8 84230951 missense probably damaging 1.00
R6648:Zswim4 UTSW 8 84230914 missense probably benign 0.22
R6920:Zswim4 UTSW 8 84214085 missense probably benign 0.01
R7117:Zswim4 UTSW 8 84214052 missense probably damaging 1.00
R7344:Zswim4 UTSW 8 84223698 nonsense probably null
R7354:Zswim4 UTSW 8 84228849 missense probably damaging 1.00
R8036:Zswim4 UTSW 8 84223289 missense probably benign 0.22
R8408:Zswim4 UTSW 8 84212385 missense possibly damaging 0.82
R8518:Zswim4 UTSW 8 84211957 missense probably damaging 1.00
R8750:Zswim4 UTSW 8 84212684 missense possibly damaging 0.82
R8830:Zswim4 UTSW 8 84223316 missense possibly damaging 0.92
R8838:Zswim4 UTSW 8 84214070 missense probably damaging 1.00
R8840:Zswim4 UTSW 8 84214070 missense probably damaging 1.00
R8842:Zswim4 UTSW 8 84214070 missense probably damaging 1.00
R9185:Zswim4 UTSW 8 84237004 start codon destroyed probably null 0.94
R9355:Zswim4 UTSW 8 84229058 missense probably damaging 1.00
R9432:Zswim4 UTSW 8 84236910 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGGTGTGGCAGAACAT -3'
(R):5'- TAGTAGCCAGTCAAATTCCAGCTC -3'

Sequencing Primer
(F):5'- CCAAGAGATTTGATGCCTCCATGG -3'
(R):5'- ATGGAACCCAGGGCCTTTGTC -3'
Posted On 2019-06-26