Mutagenetix > Incidental Mutation

Incidental Mutation 'R7155:Smad6'

557225

Institutional Source

Beutler Lab

Gene Symbol

Smad6

Ensembl Gene

ENSMUSG00000036867

Gene Name

SMAD family member 6

Synonyms

Madh6, b2b390Clo, Smad 6

MMRRC Submission

045226-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.744) question?

Stock #

R7155 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

63953076-64022059 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 64021787 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 82 (D82E)

Ref Sequence

ENSEMBL: ENSMUSP00000137442 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041029] [ENSMUST00000179458]

AlphaFold

O35182

Predicted Effect

probably benign
Transcript: ENSMUST00000041029

SMART Domains

Protein: ENSMUSP00000036285
Gene: ENSMUSG00000036867

Domain	Start	End	E-Value	Type
Blast:DWA	2	143	9e-43	BLAST
DWA	168	274	1.17e-51	SMART
DWB	330	492	3.62e-89	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000179458
AA Change: D82E

SMART Domains

Protein: ENSMUSP00000137442
Gene: ENSMUSG00000036867
AA Change: D82E

Domain	Start	End	E-Value	Type
low complexity region	15	31	N/A	INTRINSIC
low complexity region	50	73	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SMAD family of proteins, which are related to Drosophila 'mothers against decapentaplegic' (Mad) and C. elegans Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein functions in the negative regulation of BMP and TGF-beta/activin-signalling. Multiple transcript variants have been found for this gene.[provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit hyperplasia of cardiac valves, septation defects, and usually, postnatal lethality. Survivors develop aortic ossification and hypertension as adults. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	A	G	2: 151,473,569	L63P	possibly damaging	Het
Abca13	A	T	11: 9,529,010	Y4286F	probably benign	Het
Aldh5a1	A	C	13: 24,911,589	V515G	possibly damaging	Het
Ankrd42	T	C	7: 92,591,933	E406G	possibly damaging	Het
Arfgef2	T	A	2: 166,865,813	M1043K	probably benign	Het
Arhgef11	T	A	3: 87,709,572	Y383*	probably null	Het
Aste1	C	T	9: 105,405,136	P614L	probably damaging	Het
B3galt5	T	A	16: 96,315,805	S213T	probably damaging	Het
Bak1	A	G	17: 27,022,460	L108P	possibly damaging	Het
Bcl6	G	A	16: 23,966,226	R675*	probably null	Het
Bdp1	T	G	13: 100,061,151	T909P	possibly damaging	Het
Cacna1i	A	G	15: 80,395,238	H2060R	probably benign	Het
Cdhr3	G	T	12: 33,061,773	P246Q	probably damaging	Het
Colgalt1	T	C	8: 71,623,710	S602P	probably damaging	Het
Csde1	T	C	3: 103,039,953	S74P	probably damaging	Het
Cyp51	A	T	5: 4,087,846	C366S	possibly damaging	Het
Dcaf7	A	G	11: 106,037,190	N23D	probably damaging	Het
Ddx10	G	A	9: 53,117,288	A772V	probably benign	Het
Ddx4	A	G	13: 112,613,785	F404S	probably benign	Het
Dirc2	G	T	16: 35,735,577	T171K	probably benign	Het
Dlg4	T	A	11: 70,017,216	M1K	probably null	Het
Dnajc6	T	C	4: 101,612,945	V293A	probably damaging	Het
Etl4	G	T	2: 20,806,931	R1643L	probably damaging	Het
F13b	G	A	1: 139,508,157	E234K	probably damaging	Het
Fam171a1	T	C	2: 3,225,729	I633T	probably benign	Het
Frem3	A	G	8: 80,616,039	I1654V	probably benign	Het
Galr2	A	G	11: 116,283,582	E346G	possibly damaging	Het
Gck	G	A	11: 5,949,705		probably benign	Het
Gen1	G	T	12: 11,241,832	T717K	probably benign	Het
Gm13083	A	T	4: 143,616,165	I281F	probably benign	Het
Gpatch8	TTCCTCCTCCTCCTCTTCCTCCTCCTC	TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC	11: 102,480,188		probably benign	Het
Hat1	A	G	2: 71,421,251	T215A	possibly damaging	Het
Hmbox1	A	T	14: 64,897,037	M38K	probably damaging	Het
Ifi47	A	G	11: 49,096,542	K379E	probably benign	Het
Ift81	T	C	5: 122,568,999	Y460C	probably damaging	Het
Jarid2	T	A	13: 44,902,462	S381R	probably damaging	Het
Kmt2b	A	T	7: 30,579,963	V1458E	probably damaging	Het
Kpna4	G	T	3: 69,089,933	P336Q	probably damaging	Het
Krt84	T	C	15: 101,532,254	R168G	probably damaging	Het
Lhx8	T	A	3: 154,324,584	Y137F	possibly damaging	Het
Lin7b	T	C	7: 45,370,227	E19G	probably damaging	Het
Lrmda	A	T	14: 22,584,540	R131S	probably damaging	Het
Lrrc75b	C	T	10: 75,553,678	A280T	possibly damaging	Het
Megf11	G	A	9: 64,647,951	R268K	probably null	Het
Mgat4e	G	T	1: 134,541,959	Q116K	probably damaging	Het
Mlkl	A	G	8: 111,319,403	L325P	probably damaging	Het
Mup2	A	G	4: 60,137,641	L134P	probably damaging	Het
Myo19	A	G	11: 84,900,586	E489G	probably damaging	Het
Ncbp3	C	A	11: 73,048,009	P37Q	probably damaging	Het
Nf2	A	G	11: 4,799,964	V236A	probably damaging	Het
Nlrp1a	A	T	11: 71,124,079	M115K	possibly damaging	Het
Nsf	T	A	11: 103,828,530	K649*	probably null	Het
Olfml2b	A	T	1: 170,666,785	I313L	probably benign	Het
Olfr316	T	A	11: 58,758,283	I206N	probably damaging	Het
Olfr654	T	A	7: 104,588,557	V251D	possibly damaging	Het
Papln	T	A	12: 83,776,521	L444Q	probably damaging	Het
Phc3	T	C	3: 30,914,197	I897V	probably benign	Het
Plcg1	T	C	2: 160,754,380	L632P	probably damaging	Het
Prkg1	T	C	19: 31,302,301	T178A	probably damaging	Het
Ptges	T	A	2: 30,892,804	T79S	probably benign	Het
Rab26	T	C	17: 24,532,289	T81A	probably damaging	Het
Rai14	T	A	15: 10,595,003	I145L	possibly damaging	Het
Rasgrf1	A	G	9: 90,002,361	T960A	possibly damaging	Het
Rfx1	A	T	8: 84,094,826	I755F	probably damaging	Het
Rims1	T	G	1: 22,432,923	L670F	probably damaging	Het
Rtkn	G	A	6: 83,149,711	C297Y	probably damaging	Het
Sec23a	A	T	12: 58,989,443	N378K	probably benign	Het
Slc17a2	A	G	13: 23,822,407	E472G	probably benign	Het
Slc1a2	T	C	2: 102,766,995	M449T	probably damaging	Het
Slc22a3	G	A	17: 12,433,631	L369F	possibly damaging	Het
Smgc	A	T	15: 91,852,608	I463F	possibly damaging	Het
Strada	C	A	11: 106,171,039	G166C	probably damaging	Het
Tcaf3	A	G	6: 42,593,891	V309A	probably benign	Het
Tet2	C	T	3: 133,469,591	E1332K	possibly damaging	Het
Tfcp2l1	A	G	1: 118,668,632	N366D	probably damaging	Het
Tll2	G	A	19: 41,117,284	P369L	possibly damaging	Het
Tox4	T	C	14: 52,292,097	V505A	probably benign	Het
Trbv4	A	G	6: 41,059,853	D104G	probably damaging	Het
Ugdh	T	C	5: 65,417,037	E416G	probably damaging	Het
Usp47	T	A	7: 112,087,013	C613S	probably damaging	Het
Vmn1r11	T	A	6: 57,138,162	N270K	probably benign	Het
Wsb2	T	A	5: 117,371,095	L147Q	probably damaging	Het
Xrn1	G	A	9: 95,979,145	A453T	possibly damaging	Het
Zan	A	G	5: 137,461,844	S1262P	unknown	Het
Zswim4	A	G	8: 84,219,927	L700P	probably damaging	Het

Other mutations in Smad6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Smad6	APN	9	63953981	missense	probably damaging	1.00
IGL02419:Smad6	APN	9	63953518	utr 3 prime	probably benign
IGL02511:Smad6	APN	9	63953577	missense	probably damaging	1.00
R3975:Smad6	UTSW	9	64020930	missense	probably benign
R5010:Smad6	UTSW	9	63953900	missense	possibly damaging	0.76
R6791:Smad6	UTSW	9	64012227	missense	probably benign
R7205:Smad6	UTSW	9	64020406	missense	probably damaging	1.00
R7573:Smad6	UTSW	9	64021770	missense	unknown
R8053:Smad6	UTSW	9	64020507	missense	probably damaging	1.00
R9132:Smad6	UTSW	9	64007588	missense	probably benign	0.27
R9258:Smad6	UTSW	9	64020291	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTTTGCACGCACGAAAAGC -3'
(R):5'- CTAGACTGGCATATGATGGGAG -3'

Sequencing Primer
(F):5'- AAGCAATTCCGTCTCAGGTC -3'
(R):5'- CAGGAGGCACTTTGGTG -3'

Posted On

2019-06-26