Incidental Mutation 'R0585:9530003J23Rik'
ID55723
Institutional Source Beutler Lab
Gene Symbol 9530003J23Rik
Ensembl Gene ENSMUSG00000020177
Gene NameRIKEN cDNA 9530003J23 gene
Synonyms
MMRRC Submission 038775-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R0585 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location117232237-117238703 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 117238451 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 44 (I44F)
Ref Sequence ENSEMBL: ENSMUSP00000125436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020392] [ENSMUST00000159193]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020392
AA Change: I44F

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020392
Gene: ENSMUSG00000020177
AA Change: I44F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LYZ1 22 150 4.85e-73 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159193
AA Change: I44F

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125436
Gene: ENSMUSG00000020177
AA Change: I44F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LYZ1 22 150 4.85e-73 SMART
Meta Mutation Damage Score 0.1371 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.2%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,550,723 V267A probably benign Het
Brdt T G 5: 107,356,882 probably null Het
Ccdc162 C T 10: 41,586,379 C1474Y probably benign Het
Ces2e T C 8: 104,929,821 S228P probably damaging Het
Clca1 G T 3: 145,032,625 H41N probably benign Het
Cyp2c39 A T 19: 39,536,759 I169F probably benign Het
Cyp2c65 A G 19: 39,069,242 K107R probably benign Het
Cyp2c67 T A 19: 39,638,694 N231Y possibly damaging Het
Eps8l3 G C 3: 107,881,197 D33H probably damaging Het
Evi5 T C 5: 107,813,536 probably benign Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Gm3993 T A 12: 20,072,148 probably null Het
Gtf2ird1 A C 5: 134,376,942 L28R probably damaging Het
Hsf4 A G 8: 105,271,031 D75G probably damaging Het
Larp4b A G 13: 9,147,493 T249A probably damaging Het
Larp4b A G 13: 9,170,701 D578G probably benign Het
Matn3 A T 12: 8,961,103 probably benign Het
Myo10 T A 15: 25,736,455 Y428N probably damaging Het
Nf1 T A 11: 79,568,701 D661E probably damaging Het
Nktr A G 9: 121,754,280 probably benign Het
Npbwr1 G A 1: 5,916,458 T279I possibly damaging Het
Olfr665 A C 7: 104,881,499 H264P probably damaging Het
Osmr T C 15: 6,837,793 I341V probably benign Het
Pan2 T C 10: 128,310,515 probably null Het
Pknox2 G A 9: 36,909,760 probably benign Het
Pla2g2d A C 4: 138,779,393 D50A probably benign Het
Ptprk C T 10: 28,575,668 L1051F probably damaging Het
Rap1gds1 G A 3: 139,021,872 T59M probably benign Het
Rps5 T C 7: 12,925,405 V41A possibly damaging Het
Ryr1 G T 7: 29,036,076 D4092E probably damaging Het
Spic T C 10: 88,676,043 Y117C probably damaging Het
Thrap3 A T 4: 126,178,574 probably null Het
Tlr9 C T 9: 106,225,076 T522I probably benign Het
Tspan3 A T 9: 56,145,932 probably benign Het
Ttn T C 2: 76,873,159 probably benign Het
Zfp773 T A 7: 7,132,575 I341L probably benign Het
Zmat3 G A 3: 32,361,105 P19S probably damaging Het
Other mutations in 9530003J23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:9530003J23Rik APN 10 117238447 missense probably benign 0.33
R0610:9530003J23Rik UTSW 10 117237730 missense probably benign 0.01
R2925:9530003J23Rik UTSW 10 117234431 missense probably benign 0.02
R6656:9530003J23Rik UTSW 10 117235629 missense probably benign 0.00
R6934:9530003J23Rik UTSW 10 117238508 missense probably benign 0.00
R7150:9530003J23Rik UTSW 10 117237742 missense probably benign 0.01
R7255:9530003J23Rik UTSW 10 117234422 missense probably benign
R7439:9530003J23Rik UTSW 10 117238697 unclassified probably benign
RF014:9530003J23Rik UTSW 10 117234417 makesense probably null
Z1177:9530003J23Rik UTSW 10 117235641 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCCTGGGAGAACGTCTTTGTAATG -3'
(R):5'- GCATGAAGCTCAAAACGTCGAGTC -3'

Sequencing Primer
(F):5'- GGAGAACGTCTTTGTAATGTAAGTC -3'
(R):5'- TAAATACTGGGGCCTGATCGC -3'
Posted On2013-07-11