Incidental Mutation 'R7155:Ifi47'
ID 557234
Institutional Source Beutler Lab
Gene Symbol Ifi47
Ensembl Gene ENSMUSG00000078920
Gene Name interferon gamma inducible protein 47
Synonyms IRG-47, Igrd, Iigp4, 47kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock # R7155 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 49076587-49096974 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 49096542 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 379 (K379E)
Ref Sequence ENSEMBL: ENSMUSP00000041975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046704] [ENSMUST00000056759] [ENSMUST00000102785] [ENSMUST00000109202] [ENSMUST00000152914] [ENSMUST00000179282] [ENSMUST00000203149] [ENSMUST00000203810] [ENSMUST00000213728] [ENSMUST00000214804]
AlphaFold Q61635
Predicted Effect probably benign
Transcript: ENSMUST00000046704
AA Change: K379E

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000041975
Gene: ENSMUSG00000078920
AA Change: K379E

DomainStartEndE-ValueType
Pfam:IIGP 40 414 1.7e-177 PFAM
Pfam:MMR_HSR1 76 219 9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056759
SMART Domains Protein: ENSMUSP00000058544
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 1.5e-33 PFAM
Pfam:7tm_4 108 252 1.7e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102785
SMART Domains Protein: ENSMUSP00000099846
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 1.5e-33 PFAM
Pfam:7tm_4 108 252 1.7e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109202
AA Change: K379E

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104825
Gene: ENSMUSG00000078920
AA Change: K379E

DomainStartEndE-ValueType
Pfam:IIGP 40 414 3.1e-175 PFAM
Pfam:Miro 76 191 2.4e-6 PFAM
Pfam:MMR_HSR1 76 211 3.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152914
Predicted Effect probably benign
Transcript: ENSMUST00000179282
SMART Domains Protein: ENSMUSP00000136647
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7tm_4 1 276 3.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 3.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203149
SMART Domains Protein: ENSMUSP00000145429
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 36 253 3.8e-7 PFAM
Pfam:7tm_1 42 291 2.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203810
SMART Domains Protein: ENSMUSP00000144951
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 36 253 3.8e-7 PFAM
Pfam:7tm_1 42 291 2.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213728
AA Change: K379E

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000214804
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: In the absence of infection, mice show no overt phenotype. Resistance to protozoan parasitic infection is impaired in homozygous mutant mice, whereas resistance to bacterial and viral infection are normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,473,569 L63P possibly damaging Het
Abca13 A T 11: 9,529,010 Y4286F probably benign Het
Aldh5a1 A C 13: 24,911,589 V515G possibly damaging Het
Ankrd42 T C 7: 92,591,933 E406G possibly damaging Het
Arfgef2 T A 2: 166,865,813 M1043K probably benign Het
Arhgef11 T A 3: 87,709,572 Y383* probably null Het
Aste1 C T 9: 105,405,136 P614L probably damaging Het
B3galt5 T A 16: 96,315,805 S213T probably damaging Het
Bak1 A G 17: 27,022,460 L108P possibly damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Bdp1 T G 13: 100,061,151 T909P possibly damaging Het
Cacna1i A G 15: 80,395,238 H2060R probably benign Het
Cdhr3 G T 12: 33,061,773 P246Q probably damaging Het
Colgalt1 T C 8: 71,623,710 S602P probably damaging Het
Csde1 T C 3: 103,039,953 S74P probably damaging Het
Cyp51 A T 5: 4,087,846 C366S possibly damaging Het
Dcaf7 A G 11: 106,037,190 N23D probably damaging Het
Ddx10 G A 9: 53,117,288 A772V probably benign Het
Ddx4 A G 13: 112,613,785 F404S probably benign Het
Dirc2 G T 16: 35,735,577 T171K probably benign Het
Dlg4 T A 11: 70,017,216 M1K probably null Het
Dnajc6 T C 4: 101,612,945 V293A probably damaging Het
Etl4 G T 2: 20,806,931 R1643L probably damaging Het
F13b G A 1: 139,508,157 E234K probably damaging Het
Fam171a1 T C 2: 3,225,729 I633T probably benign Het
Frem3 A G 8: 80,616,039 I1654V probably benign Het
Galr2 A G 11: 116,283,582 E346G possibly damaging Het
Gck G A 11: 5,949,705 probably benign Het
Gen1 G T 12: 11,241,832 T717K probably benign Het
Gm13083 A T 4: 143,616,165 I281F probably benign Het
Gpatch8 TTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC 11: 102,480,188 probably benign Het
Hat1 A G 2: 71,421,251 T215A possibly damaging Het
Hmbox1 A T 14: 64,897,037 M38K probably damaging Het
Ift81 T C 5: 122,568,999 Y460C probably damaging Het
Jarid2 T A 13: 44,902,462 S381R probably damaging Het
Kmt2b A T 7: 30,579,963 V1458E probably damaging Het
Kpna4 G T 3: 69,089,933 P336Q probably damaging Het
Krt84 T C 15: 101,532,254 R168G probably damaging Het
Lhx8 T A 3: 154,324,584 Y137F possibly damaging Het
Lin7b T C 7: 45,370,227 E19G probably damaging Het
Lrmda A T 14: 22,584,540 R131S probably damaging Het
Lrrc75b C T 10: 75,553,678 A280T possibly damaging Het
Megf11 G A 9: 64,647,951 R268K probably null Het
Mgat4e G T 1: 134,541,959 Q116K probably damaging Het
Mlkl A G 8: 111,319,403 L325P probably damaging Het
Mup2 A G 4: 60,137,641 L134P probably damaging Het
Myo19 A G 11: 84,900,586 E489G probably damaging Het
Ncbp3 C A 11: 73,048,009 P37Q probably damaging Het
Nf2 A G 11: 4,799,964 V236A probably damaging Het
Nlrp1a A T 11: 71,124,079 M115K possibly damaging Het
Nsf T A 11: 103,828,530 K649* probably null Het
Olfml2b A T 1: 170,666,785 I313L probably benign Het
Olfr316 T A 11: 58,758,283 I206N probably damaging Het
Olfr654 T A 7: 104,588,557 V251D possibly damaging Het
Papln T A 12: 83,776,521 L444Q probably damaging Het
Phc3 T C 3: 30,914,197 I897V probably benign Het
Plcg1 T C 2: 160,754,380 L632P probably damaging Het
Prkg1 T C 19: 31,302,301 T178A probably damaging Het
Ptges T A 2: 30,892,804 T79S probably benign Het
Rab26 T C 17: 24,532,289 T81A probably damaging Het
Rai14 T A 15: 10,595,003 I145L possibly damaging Het
Rasgrf1 A G 9: 90,002,361 T960A possibly damaging Het
Rfx1 A T 8: 84,094,826 I755F probably damaging Het
Rims1 T G 1: 22,432,923 L670F probably damaging Het
Rtkn G A 6: 83,149,711 C297Y probably damaging Het
Sec23a A T 12: 58,989,443 N378K probably benign Het
Slc17a2 A G 13: 23,822,407 E472G probably benign Het
Slc1a2 T C 2: 102,766,995 M449T probably damaging Het
Slc22a3 G A 17: 12,433,631 L369F possibly damaging Het
Smad6 G T 9: 64,021,787 D82E unknown Het
Smgc A T 15: 91,852,608 I463F possibly damaging Het
Strada C A 11: 106,171,039 G166C probably damaging Het
Tcaf3 A G 6: 42,593,891 V309A probably benign Het
Tet2 C T 3: 133,469,591 E1332K possibly damaging Het
Tfcp2l1 A G 1: 118,668,632 N366D probably damaging Het
Tll2 G A 19: 41,117,284 P369L possibly damaging Het
Tox4 T C 14: 52,292,097 V505A probably benign Het
Trbv4 A G 6: 41,059,853 D104G probably damaging Het
Ugdh T C 5: 65,417,037 E416G probably damaging Het
Usp47 T A 7: 112,087,013 C613S probably damaging Het
Vmn1r11 T A 6: 57,138,162 N270K probably benign Het
Wsb2 T A 5: 117,371,095 L147Q probably damaging Het
Xrn1 G A 9: 95,979,145 A453T possibly damaging Het
Zan A G 5: 137,461,844 S1262P unknown Het
Zswim4 A G 8: 84,219,927 L700P probably damaging Het
Other mutations in Ifi47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Ifi47 APN 11 49095414 nonsense probably null
IGL00811:Ifi47 APN 11 49095417 missense probably benign 0.00
IGL02451:Ifi47 APN 11 49095777 missense probably damaging 1.00
IGL02468:Ifi47 APN 11 49095983 missense probably damaging 0.98
IGL02902:Ifi47 APN 11 49095790 missense probably benign 0.00
IGL03260:Ifi47 APN 11 49096105 missense probably damaging 0.99
R0111:Ifi47 UTSW 11 49096070 missense probably damaging 1.00
R0636:Ifi47 UTSW 11 49096651 missense possibly damaging 0.85
R1548:Ifi47 UTSW 11 49095871 missense probably damaging 1.00
R2255:Ifi47 UTSW 11 49096647 missense probably benign 0.02
R3703:Ifi47 UTSW 11 49095525 missense probably benign 0.01
R5071:Ifi47 UTSW 11 49095534 missense probably benign 0.01
R5073:Ifi47 UTSW 11 49095534 missense probably benign 0.01
R5074:Ifi47 UTSW 11 49095534 missense probably benign 0.01
R5262:Ifi47 UTSW 11 49095732 missense probably benign 0.00
R5902:Ifi47 UTSW 11 49095386 splice site probably null
R6745:Ifi47 UTSW 11 49095502 missense probably benign 0.38
R7535:Ifi47 UTSW 11 49096625 missense probably damaging 1.00
R8330:Ifi47 UTSW 11 49095810 missense possibly damaging 0.55
R8412:Ifi47 UTSW 11 49095598 missense probably damaging 0.98
R9076:Ifi47 UTSW 11 49096015 missense probably benign
Z1177:Ifi47 UTSW 11 49096275 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCCTGAACAAGAACAGTGC -3'
(R):5'- TTTGGTGGAAGGACAACCAACC -3'

Sequencing Primer
(F):5'- GAAGGATTACCGAAGCTATTTTGGC -3'
(R):5'- ACCCCATTGCCAATTTGGAC -3'
Posted On 2019-06-26