Incidental Mutation 'R7155:Dcaf7'
ID557242
Institutional Source Beutler Lab
Gene Symbol Dcaf7
Ensembl Gene ENSMUSG00000049354
Gene NameDDB1 and CUL4 associated factor 7
Synonyms1700012F10Rik, 2610037L01Rik, Wdr68
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7155 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location106036872-106059324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106037190 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 23 (N23D)
Ref Sequence ENSEMBL: ENSMUSP00000058168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001965] [ENSMUST00000058438] [ENSMUST00000106903] [ENSMUST00000145539]
Predicted Effect probably benign
Transcript: ENSMUST00000001965
SMART Domains Protein: ENSMUSP00000001965
Gene: ENSMUSG00000001901

DomainStartEndE-ValueType
Blast:PAS 13 87 2e-43 BLAST
PAC 93 135 4.06e-2 SMART
low complexity region 139 152 N/A INTRINSIC
low complexity region 158 173 N/A INTRINSIC
Pfam:Ion_trans 256 523 6.8e-40 PFAM
Pfam:Ion_trans_2 445 517 2.6e-13 PFAM
cNMP 594 712 3.21e-23 SMART
coiled coil region 782 809 N/A INTRINSIC
low complexity region 901 912 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000058438
AA Change: N23D

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058168
Gene: ENSMUSG00000049354
AA Change: N23D

DomainStartEndE-ValueType
WD40 58 99 3.42e1 SMART
WD40 104 149 1.43e1 SMART
WD40 163 205 3.81e-5 SMART
WD40 211 251 1.1e2 SMART
WD40 255 295 8.88e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106903
SMART Domains Protein: ENSMUSP00000102516
Gene: ENSMUSG00000001901

DomainStartEndE-ValueType
Blast:PAS 13 87 3e-43 BLAST
PAC 93 135 4.06e-2 SMART
low complexity region 139 152 N/A INTRINSIC
low complexity region 158 173 N/A INTRINSIC
transmembrane domain 258 280 N/A INTRINSIC
Pfam:Ion_trans 302 420 6.2e-10 PFAM
Pfam:Ion_trans_2 395 464 2.6e-9 PFAM
cNMP 541 659 3.21e-23 SMART
coiled coil region 729 756 N/A INTRINSIC
low complexity region 848 859 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145539
SMART Domains Protein: ENSMUSP00000137675
Gene: ENSMUSG00000001901

DomainStartEndE-ValueType
Blast:PAS 13 87 3e-43 BLAST
PAC 93 135 4.06e-2 SMART
low complexity region 139 152 N/A INTRINSIC
low complexity region 158 173 N/A INTRINSIC
transmembrane domain 261 283 N/A INTRINSIC
Pfam:Ion_trans 302 511 1.4e-22 PFAM
Pfam:Ion_trans_2 442 517 2e-13 PFAM
cNMP 594 712 3.21e-23 SMART
low complexity region 764 775 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with multiple WD40 repeats which facilitate protein-protein interactions and thereby enable the assembly of multiprotein complexes. This protein has been shown to function as a scaffold protein for protein complexes involved in kinase signaling. This highly conserved gene is present in eukaryotic plants, fungi, and animals. The ortholog of this gene was first identified in plants as a key regulator of anthocyanin biosynthesis and flower pigmentation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,473,569 L63P possibly damaging Het
Abca13 A T 11: 9,529,010 Y4286F probably benign Het
Aldh5a1 A C 13: 24,911,589 V515G possibly damaging Het
Ankrd42 T C 7: 92,591,933 E406G possibly damaging Het
Arfgef2 T A 2: 166,865,813 M1043K probably benign Het
Arhgef11 T A 3: 87,709,572 Y383* probably null Het
Aste1 C T 9: 105,405,136 P614L probably damaging Het
B3galt5 T A 16: 96,315,805 S213T probably damaging Het
Bak1 A G 17: 27,022,460 L108P possibly damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Bdp1 T G 13: 100,061,151 T909P possibly damaging Het
Cacna1i A G 15: 80,395,238 H2060R probably benign Het
Cdhr3 G T 12: 33,061,773 P246Q probably damaging Het
Colgalt1 T C 8: 71,623,710 S602P probably damaging Het
Csde1 T C 3: 103,039,953 S74P probably damaging Het
Cyp51 A T 5: 4,087,846 C366S possibly damaging Het
Ddx10 G A 9: 53,117,288 A772V probably benign Het
Ddx4 A G 13: 112,613,785 F404S probably benign Het
Dirc2 G T 16: 35,735,577 T171K probably benign Het
Dlg4 T A 11: 70,017,216 M1K probably null Het
Dnajc6 T C 4: 101,612,945 V293A probably damaging Het
Etl4 G T 2: 20,806,931 R1643L probably damaging Het
F13b G A 1: 139,508,157 E234K probably damaging Het
Fam171a1 T C 2: 3,225,729 I633T probably benign Het
Frem3 A G 8: 80,616,039 I1654V probably benign Het
Galr2 A G 11: 116,283,582 E346G possibly damaging Het
Gck G A 11: 5,949,705 probably benign Het
Gen1 G T 12: 11,241,832 T717K probably benign Het
Gm13083 A T 4: 143,616,165 I281F probably benign Het
Gpatch8 TTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC 11: 102,480,188 probably benign Het
Hat1 A G 2: 71,421,251 T215A possibly damaging Het
Hmbox1 A T 14: 64,897,037 M38K probably damaging Het
Ifi47 A G 11: 49,096,542 K379E probably benign Het
Ift81 T C 5: 122,568,999 Y460C probably damaging Het
Jarid2 T A 13: 44,902,462 S381R probably damaging Het
Kmt2b A T 7: 30,579,963 V1458E probably damaging Het
Kpna4 G T 3: 69,089,933 P336Q probably damaging Het
Krt84 T C 15: 101,532,254 R168G probably damaging Het
Lhx8 T A 3: 154,324,584 Y137F possibly damaging Het
Lin7b T C 7: 45,370,227 E19G probably damaging Het
Lrmda A T 14: 22,584,540 R131S probably damaging Het
Lrrc75b C T 10: 75,553,678 A280T possibly damaging Het
Megf11 G A 9: 64,647,951 R268K probably null Het
Mgat4e G T 1: 134,541,959 Q116K probably damaging Het
Mlkl A G 8: 111,319,403 L325P probably damaging Het
Mup2 A G 4: 60,137,641 L134P probably damaging Het
Myo19 A G 11: 84,900,586 E489G probably damaging Het
Ncbp3 C A 11: 73,048,009 P37Q probably damaging Het
Nf2 A G 11: 4,799,964 V236A probably damaging Het
Nlrp1a A T 11: 71,124,079 M115K possibly damaging Het
Nsf T A 11: 103,828,530 K649* probably null Het
Olfml2b A T 1: 170,666,785 I313L probably benign Het
Olfr316 T A 11: 58,758,283 I206N probably damaging Het
Olfr654 T A 7: 104,588,557 V251D possibly damaging Het
Papln T A 12: 83,776,521 L444Q probably damaging Het
Phc3 T C 3: 30,914,197 I897V probably benign Het
Plcg1 T C 2: 160,754,380 L632P probably damaging Het
Prkg1 T C 19: 31,302,301 T178A probably damaging Het
Ptges T A 2: 30,892,804 T79S probably benign Het
Rab26 T C 17: 24,532,289 T81A probably damaging Het
Rai14 T A 15: 10,595,003 I145L possibly damaging Het
Rasgrf1 A G 9: 90,002,361 T960A possibly damaging Het
Rfx1 A T 8: 84,094,826 I755F probably damaging Het
Rims1 T G 1: 22,432,923 L670F probably damaging Het
Rtkn G A 6: 83,149,711 C297Y probably damaging Het
Sec23a A T 12: 58,989,443 N378K probably benign Het
Slc17a2 A G 13: 23,822,407 E472G probably benign Het
Slc1a2 T C 2: 102,766,995 M449T probably damaging Het
Slc22a3 G A 17: 12,433,631 L369F possibly damaging Het
Smad6 G T 9: 64,021,787 D82E unknown Het
Smgc A T 15: 91,852,608 I463F possibly damaging Het
Strada C A 11: 106,171,039 G166C probably damaging Het
Tcaf3 A G 6: 42,593,891 V309A probably benign Het
Tet2 C T 3: 133,469,591 E1332K possibly damaging Het
Tfcp2l1 A G 1: 118,668,632 N366D probably damaging Het
Tll2 G A 19: 41,117,284 P369L possibly damaging Het
Tox4 T C 14: 52,292,097 V505A probably benign Het
Trbv4 A G 6: 41,059,853 D104G probably damaging Het
Ugdh T C 5: 65,417,037 E416G probably damaging Het
Usp47 T A 7: 112,087,013 C613S probably damaging Het
Vmn1r11 T A 6: 57,138,162 N270K probably benign Het
Wsb2 T A 5: 117,371,095 L147Q probably damaging Het
Xrn1 G A 9: 95,979,145 A453T possibly damaging Het
Zan A G 5: 137,461,844 S1262P unknown Het
Zswim4 A G 8: 84,219,927 L700P probably damaging Het
Other mutations in Dcaf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Dcaf7 APN 11 106054746 missense probably damaging 1.00
IGL01584:Dcaf7 APN 11 106053827 missense probably benign 0.12
IGL02398:Dcaf7 APN 11 106053753 missense probably benign 0.03
IGL02516:Dcaf7 APN 11 106051872 missense probably damaging 1.00
IGL02672:Dcaf7 APN 11 106054858 utr 3 prime probably benign
IGL02892:Dcaf7 APN 11 106046692 missense possibly damaging 0.95
IGL02953:Dcaf7 APN 11 106051876 nonsense probably null
R0179:Dcaf7 UTSW 11 106051797 missense probably damaging 0.98
R0539:Dcaf7 UTSW 11 106051826 missense probably damaging 0.98
R1471:Dcaf7 UTSW 11 106046747 missense probably benign 0.01
R1647:Dcaf7 UTSW 11 106051802 missense probably damaging 1.00
R1648:Dcaf7 UTSW 11 106051802 missense probably damaging 1.00
R3551:Dcaf7 UTSW 11 106054796 missense probably benign 0.00
R4656:Dcaf7 UTSW 11 106053798 missense probably damaging 1.00
R6167:Dcaf7 UTSW 11 106037251 missense probably damaging 0.99
R6192:Dcaf7 UTSW 11 106051758 missense probably damaging 1.00
R6782:Dcaf7 UTSW 11 106054755 missense probably damaging 1.00
R6864:Dcaf7 UTSW 11 106046821 missense probably damaging 1.00
R7253:Dcaf7 UTSW 11 106047843 intron probably null
R7446:Dcaf7 UTSW 11 106053735 missense probably benign 0.04
R7631:Dcaf7 UTSW 11 106053753 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCGAGCTGGTTTGAAACTGG -3'
(R):5'- TCAAGGCGAGTTTGCAGGAG -3'

Sequencing Primer
(F):5'- AGTGTGTGTAGCCGAGGACC -3'
(R):5'- GCGAGTTTGCAGGAGAGTTG -3'
Posted On2019-06-26