Incidental Mutation 'R7155:Slc34a1'
ID 557249
Institutional Source Beutler Lab
Gene Symbol Slc34a1
Ensembl Gene ENSMUSG00000021490
Gene Name solute carrier family 34 (sodium phosphate), member 1
Synonyms Slc17a2, Npt2, Na/Pi cotransporter, renal Na+/Pi transporter, NaPi-IIa
MMRRC Submission 045226-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R7155 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 55547435-55562508 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24006390 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 472 (E472G)
Ref Sequence ENSEMBL: ENSMUSP00000097288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006786] [ENSMUST00000099697]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000006786
SMART Domains Protein: ENSMUSP00000006786
Gene: ENSMUSG00000036110

DomainStartEndE-ValueType
Pfam:MFS_1 19 425 3.5e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099697
AA Change: E472G

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097288
Gene: ENSMUSG00000036110
AA Change: E472G

DomainStartEndE-ValueType
Pfam:MFS_1 19 425 2.9e-45 PFAM
transmembrane domain 443 462 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II sodium-phosphate cotransporter family. Mutations in this gene are associated with hypophosphatemia nephrolithiasis/osteoporosis 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous null mice exhibit renal phosphate wasting, hyerpcalciuria, and skeletal abnormalities. Postnatal viability is reduced, putatively due to poor nutritional status. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,315,489 (GRCm39) L63P possibly damaging Het
Abca13 A T 11: 9,479,010 (GRCm39) Y4286F probably benign Het
Aldh5a1 A C 13: 25,095,572 (GRCm39) V515G possibly damaging Het
Ankrd42 T C 7: 92,241,141 (GRCm39) E406G possibly damaging Het
Arfgef2 T A 2: 166,707,733 (GRCm39) M1043K probably benign Het
Arhgef11 T A 3: 87,616,879 (GRCm39) Y383* probably null Het
Aste1 C T 9: 105,282,335 (GRCm39) P614L probably damaging Het
B3galt5 T A 16: 96,117,005 (GRCm39) S213T probably damaging Het
Bak1 A G 17: 27,241,434 (GRCm39) L108P possibly damaging Het
Bcl6 G A 16: 23,784,976 (GRCm39) R675* probably null Het
Bdp1 T G 13: 100,197,659 (GRCm39) T909P possibly damaging Het
Cacna1i A G 15: 80,279,439 (GRCm39) H2060R probably benign Het
Cdhr3 G T 12: 33,111,772 (GRCm39) P246Q probably damaging Het
Colgalt1 T C 8: 72,076,354 (GRCm39) S602P probably damaging Het
Csde1 T C 3: 102,947,269 (GRCm39) S74P probably damaging Het
Cyp51 A T 5: 4,137,846 (GRCm39) C366S possibly damaging Het
Dcaf7 A G 11: 105,928,016 (GRCm39) N23D probably damaging Het
Ddx10 G A 9: 53,028,588 (GRCm39) A772V probably benign Het
Ddx4 A G 13: 112,750,319 (GRCm39) F404S probably benign Het
Dlg4 T A 11: 69,908,042 (GRCm39) M1K probably null Het
Dnajc6 T C 4: 101,470,142 (GRCm39) V293A probably damaging Het
Etl4 G T 2: 20,811,742 (GRCm39) R1643L probably damaging Het
F13b G A 1: 139,435,895 (GRCm39) E234K probably damaging Het
Fam171a1 T C 2: 3,226,766 (GRCm39) I633T probably benign Het
Frem3 A G 8: 81,342,668 (GRCm39) I1654V probably benign Het
Galr2 A G 11: 116,174,408 (GRCm39) E346G possibly damaging Het
Gck G A 11: 5,899,705 (GRCm39) probably benign Het
Gen1 G T 12: 11,291,833 (GRCm39) T717K probably benign Het
Gpatch8 TTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC 11: 102,371,014 (GRCm39) probably benign Het
Hat1 A G 2: 71,251,595 (GRCm39) T215A possibly damaging Het
Hmbox1 A T 14: 65,134,486 (GRCm39) M38K probably damaging Het
Ifi47 A G 11: 48,987,369 (GRCm39) K379E probably benign Het
Ift81 T C 5: 122,707,062 (GRCm39) Y460C probably damaging Het
Jarid2 T A 13: 45,055,938 (GRCm39) S381R probably damaging Het
Kmt2b A T 7: 30,279,388 (GRCm39) V1458E probably damaging Het
Kpna4 G T 3: 68,997,266 (GRCm39) P336Q probably damaging Het
Krt84 T C 15: 101,440,689 (GRCm39) R168G probably damaging Het
Lhx8 T A 3: 154,030,221 (GRCm39) Y137F possibly damaging Het
Lin7b T C 7: 45,019,651 (GRCm39) E19G probably damaging Het
Lrmda A T 14: 22,634,608 (GRCm39) R131S probably damaging Het
Lrrc75b C T 10: 75,389,512 (GRCm39) A280T possibly damaging Het
Megf11 G A 9: 64,555,233 (GRCm39) R268K probably null Het
Mgat4e G T 1: 134,469,697 (GRCm39) Q116K probably damaging Het
Mlkl A G 8: 112,046,035 (GRCm39) L325P probably damaging Het
Mup2 A G 4: 60,137,641 (GRCm39) L134P probably damaging Het
Myo19 A G 11: 84,791,412 (GRCm39) E489G probably damaging Het
Ncbp3 C A 11: 72,938,835 (GRCm39) P37Q probably damaging Het
Nf2 A G 11: 4,749,964 (GRCm39) V236A probably damaging Het
Nlrp1a A T 11: 71,014,905 (GRCm39) M115K possibly damaging Het
Nsf T A 11: 103,719,356 (GRCm39) K649* probably null Het
Olfml2b A T 1: 170,494,354 (GRCm39) I313L probably benign Het
Or2ak4 T A 11: 58,649,109 (GRCm39) I206N probably damaging Het
Or52u1 T A 7: 104,237,764 (GRCm39) V251D possibly damaging Het
Papln T A 12: 83,823,295 (GRCm39) L444Q probably damaging Het
Phc3 T C 3: 30,968,346 (GRCm39) I897V probably benign Het
Plcg1 T C 2: 160,596,300 (GRCm39) L632P probably damaging Het
Pramel21 A T 4: 143,342,735 (GRCm39) I281F probably benign Het
Prkg1 T C 19: 31,279,701 (GRCm39) T178A probably damaging Het
Ptges T A 2: 30,782,816 (GRCm39) T79S probably benign Het
Rab26 T C 17: 24,751,263 (GRCm39) T81A probably damaging Het
Rai14 T A 15: 10,595,089 (GRCm39) I145L possibly damaging Het
Rasgrf1 A G 9: 89,884,414 (GRCm39) T960A possibly damaging Het
Rfx1 A T 8: 84,821,455 (GRCm39) I755F probably damaging Het
Rims1 T G 1: 22,503,174 (GRCm39) L670F probably damaging Het
Rtkn G A 6: 83,126,692 (GRCm39) C297Y probably damaging Het
Sec23a A T 12: 59,036,229 (GRCm39) N378K probably benign Het
Slc1a2 T C 2: 102,597,340 (GRCm39) M449T probably damaging Het
Slc22a3 G A 17: 12,652,518 (GRCm39) L369F possibly damaging Het
Slc49a4 G T 16: 35,555,947 (GRCm39) T171K probably benign Het
Smad6 G T 9: 63,929,069 (GRCm39) D82E unknown Het
Smgc A T 15: 91,736,811 (GRCm39) I463F possibly damaging Het
Strada C A 11: 106,061,865 (GRCm39) G166C probably damaging Het
Tcaf3 A G 6: 42,570,825 (GRCm39) V309A probably benign Het
Tet2 C T 3: 133,175,352 (GRCm39) E1332K possibly damaging Het
Tfcp2l1 A G 1: 118,596,362 (GRCm39) N366D probably damaging Het
Tll2 G A 19: 41,105,723 (GRCm39) P369L possibly damaging Het
Tox4 T C 14: 52,529,554 (GRCm39) V505A probably benign Het
Trbv4 A G 6: 41,036,787 (GRCm39) D104G probably damaging Het
Ugdh T C 5: 65,574,380 (GRCm39) E416G probably damaging Het
Usp47 T A 7: 111,686,220 (GRCm39) C613S probably damaging Het
Vmn1r11 T A 6: 57,115,147 (GRCm39) N270K probably benign Het
Wsb2 T A 5: 117,509,160 (GRCm39) L147Q probably damaging Het
Xrn1 G A 9: 95,861,198 (GRCm39) A453T possibly damaging Het
Zan A G 5: 137,460,106 (GRCm39) S1262P unknown Het
Zswim4 A G 8: 84,946,556 (GRCm39) L700P probably damaging Het
Other mutations in Slc34a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Slc34a1 APN 13 24,003,317 (GRCm39) missense probably benign 0.13
IGL01120:Slc34a1 APN 13 55,556,884 (GRCm39) missense probably damaging 1.00
IGL01396:Slc34a1 APN 13 55,550,546 (GRCm39) missense probably damaging 1.00
IGL01405:Slc34a1 APN 13 55,559,941 (GRCm39) missense probably damaging 1.00
IGL01511:Slc34a1 APN 13 24,003,121 (GRCm39) critical splice donor site probably null
IGL01624:Slc34a1 APN 13 23,998,969 (GRCm39) missense probably benign 0.00
IGL01839:Slc34a1 APN 13 23,996,668 (GRCm39) missense possibly damaging 0.91
IGL02010:Slc34a1 APN 13 24,003,025 (GRCm39) missense probably benign 0.00
IGL02525:Slc34a1 APN 13 55,551,051 (GRCm39) splice site probably benign
IGL02555:Slc34a1 APN 13 55,548,981 (GRCm39) missense possibly damaging 0.77
IGL02692:Slc34a1 APN 13 55,551,049 (GRCm39) splice site probably benign
IGL03173:Slc34a1 APN 13 55,561,089 (GRCm39) missense probably damaging 0.99
IGL03221:Slc34a1 APN 13 55,548,591 (GRCm39) missense probably benign 0.00
IGL03299:Slc34a1 APN 13 24,005,094 (GRCm39) critical splice donor site probably null
Rockies UTSW 13 24,003,317 (GRCm39) missense probably damaging 0.99
R0190:Slc34a1 UTSW 13 55,556,914 (GRCm39) missense probably benign 0.00
R0196:Slc34a1 UTSW 13 55,560,078 (GRCm39) missense probably damaging 0.99
R0362:Slc34a1 UTSW 13 55,550,711 (GRCm39) splice site probably null
R0622:Slc34a1 UTSW 13 23,996,594 (GRCm39) missense probably damaging 1.00
R1055:Slc34a1 UTSW 13 55,550,846 (GRCm39) missense probably benign 0.26
R1104:Slc34a1 UTSW 13 24,003,920 (GRCm39) missense probably damaging 0.99
R1243:Slc34a1 UTSW 13 55,559,944 (GRCm39) missense possibly damaging 0.85
R1414:Slc34a1 UTSW 13 55,548,524 (GRCm39) missense probably benign
R1530:Slc34a1 UTSW 13 24,003,052 (GRCm39) missense probably damaging 1.00
R1566:Slc34a1 UTSW 13 55,559,844 (GRCm39) critical splice acceptor site probably null
R1682:Slc34a1 UTSW 13 23,996,623 (GRCm39) missense probably damaging 0.96
R1732:Slc34a1 UTSW 13 55,561,233 (GRCm39) missense probably benign
R1901:Slc34a1 UTSW 13 55,548,963 (GRCm39) nonsense probably null
R2255:Slc34a1 UTSW 13 24,004,991 (GRCm39) missense probably benign 0.09
R2423:Slc34a1 UTSW 13 55,556,865 (GRCm39) missense possibly damaging 0.63
R2986:Slc34a1 UTSW 13 55,551,142 (GRCm39) missense probably benign 0.00
R3940:Slc34a1 UTSW 13 55,560,983 (GRCm39) missense probably damaging 1.00
R4003:Slc34a1 UTSW 13 55,550,474 (GRCm39) splice site probably benign
R4553:Slc34a1 UTSW 13 55,559,874 (GRCm39) splice site probably null
R4735:Slc34a1 UTSW 13 55,561,397 (GRCm39) missense probably benign 0.13
R4923:Slc34a1 UTSW 13 24,003,078 (GRCm39) missense probably benign 0.20
R5177:Slc34a1 UTSW 13 55,548,975 (GRCm39) missense probably damaging 0.99
R5193:Slc34a1 UTSW 13 24,003,845 (GRCm39) critical splice acceptor site probably null
R5321:Slc34a1 UTSW 13 23,996,614 (GRCm39) missense possibly damaging 0.95
R5334:Slc34a1 UTSW 13 24,003,034 (GRCm39) missense probably damaging 0.97
R5345:Slc34a1 UTSW 13 55,548,331 (GRCm39) missense probably benign
R5363:Slc34a1 UTSW 13 55,560,103 (GRCm39) missense probably damaging 1.00
R5363:Slc34a1 UTSW 13 55,551,081 (GRCm39) missense probably benign 0.16
R5377:Slc34a1 UTSW 13 23,996,575 (GRCm39) missense probably damaging 1.00
R5668:Slc34a1 UTSW 13 55,556,898 (GRCm39) missense possibly damaging 0.94
R5685:Slc34a1 UTSW 13 55,549,085 (GRCm39) critical splice donor site probably null
R5782:Slc34a1 UTSW 13 55,550,501 (GRCm39) missense possibly damaging 0.92
R5836:Slc34a1 UTSW 13 55,561,278 (GRCm39) missense probably benign 0.05
R6047:Slc34a1 UTSW 13 55,559,884 (GRCm39) missense probably damaging 1.00
R6165:Slc34a1 UTSW 13 23,999,053 (GRCm39) missense probably benign 0.00
R6280:Slc34a1 UTSW 13 24,006,377 (GRCm39) missense probably benign
R6311:Slc34a1 UTSW 13 23,999,005 (GRCm39) missense probably benign 0.40
R6323:Slc34a1 UTSW 13 23,998,969 (GRCm39) missense probably benign 0.00
R6476:Slc34a1 UTSW 13 23,996,569 (GRCm39) missense probably damaging 1.00
R6496:Slc34a1 UTSW 13 55,550,495 (GRCm39) missense probably benign 0.15
R6814:Slc34a1 UTSW 13 24,006,372 (GRCm39) missense possibly damaging 0.55
R7158:Slc34a1 UTSW 13 55,549,044 (GRCm39) missense probably damaging 0.99
R7188:Slc34a1 UTSW 13 24,006,348 (GRCm39) missense probably damaging 1.00
R7288:Slc34a1 UTSW 13 24,003,095 (GRCm39) missense probably benign 0.09
R7384:Slc34a1 UTSW 13 55,550,747 (GRCm39) missense probably benign 0.00
R7462:Slc34a1 UTSW 13 24,006,401 (GRCm39) missense probably damaging 1.00
R7694:Slc34a1 UTSW 13 55,561,221 (GRCm39) missense probably benign 0.22
R7808:Slc34a1 UTSW 13 24,003,317 (GRCm39) missense probably damaging 0.99
R7937:Slc34a1 UTSW 13 23,996,648 (GRCm39) missense probably benign
R8444:Slc34a1 UTSW 13 24,003,061 (GRCm39) missense probably benign 0.00
R8447:Slc34a1 UTSW 13 24,006,309 (GRCm39) missense possibly damaging 0.50
R8932:Slc34a1 UTSW 13 24,004,184 (GRCm39) missense probably benign 0.00
R8977:Slc34a1 UTSW 13 55,556,815 (GRCm39) missense probably benign 0.01
R9635:Slc34a1 UTSW 13 55,556,940 (GRCm39) missense probably damaging 1.00
X0022:Slc34a1 UTSW 13 55,550,828 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCAAAGGACTTGTATAATTGGTAGG -3'
(R):5'- CTCTACCATTATCAAACACAGTTGC -3'

Sequencing Primer
(F):5'- TCTGAATCAGGATGGAGGA -3'
(R):5'- CTAAAACTTAGTGGCACCTGGGTTC -3'
Posted On 2019-06-26