Incidental Mutation 'R7155:Ddx4'
ID557253
Institutional Source Beutler Lab
Gene Symbol Ddx4
Ensembl Gene ENSMUSG00000021758
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 4
SynonymsMvh, VASA, mvh / m'vasa
MMRRC Submission
Accession Numbers

Genbank: NM_001145885, NM_010029

Is this an essential gene? Probably essential (E-score: 0.784) question?
Stock #R7155 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location112598333-112652475 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112613785 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 404 (F404S)
Ref Sequence ENSEMBL: ENSMUSP00000096769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075748] [ENSMUST00000099166]
Predicted Effect probably benign
Transcript: ENSMUST00000075748
AA Change: F378S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000075157
Gene: ENSMUSG00000021758
AA Change: F378S

DomainStartEndE-ValueType
Blast:DEXDc 22 165 8e-14 BLAST
low complexity region 175 183 N/A INTRINSIC
low complexity region 221 229 N/A INTRINSIC
DEXDc 280 491 9.38e-59 SMART
HELICc 527 608 1.18e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099166
AA Change: F404S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000096769
Gene: ENSMUSG00000021758
AA Change: F404S

DomainStartEndE-ValueType
Blast:DEXDc 41 191 7e-25 BLAST
low complexity region 201 209 N/A INTRINSIC
low complexity region 247 255 N/A INTRINSIC
DEXDc 306 517 9.38e-59 SMART
HELICc 553 634 1.18e-32 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a homolog of VASA proteins in Drosophila and several other species. The gene is specifically expressed in the germ cell lineage in both sexes and functions in germ cell development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Spermatogenesis is blocked in homozygous mutant mice, resulting in male infertility. Female mutant mice are fertile and do not exhibit any obvious reproductive defects. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(3) Gene trapped(2)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,473,569 L63P possibly damaging Het
Abca13 A T 11: 9,529,010 Y4286F probably benign Het
Aldh5a1 A C 13: 24,911,589 V515G possibly damaging Het
Ankrd42 T C 7: 92,591,933 E406G possibly damaging Het
Arfgef2 T A 2: 166,865,813 M1043K probably benign Het
Arhgef11 T A 3: 87,709,572 Y383* probably null Het
Aste1 C T 9: 105,405,136 P614L probably damaging Het
B3galt5 T A 16: 96,315,805 S213T probably damaging Het
Bak1 A G 17: 27,022,460 L108P possibly damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Bdp1 T G 13: 100,061,151 T909P possibly damaging Het
Cacna1i A G 15: 80,395,238 H2060R probably benign Het
Cdhr3 G T 12: 33,061,773 P246Q probably damaging Het
Colgalt1 T C 8: 71,623,710 S602P probably damaging Het
Csde1 T C 3: 103,039,953 S74P probably damaging Het
Cyp51 A T 5: 4,087,846 C366S possibly damaging Het
Dcaf7 A G 11: 106,037,190 N23D probably damaging Het
Ddx10 G A 9: 53,117,288 A772V probably benign Het
Dirc2 G T 16: 35,735,577 T171K probably benign Het
Dlg4 T A 11: 70,017,216 M1K probably null Het
Dnajc6 T C 4: 101,612,945 V293A probably damaging Het
Etl4 G T 2: 20,806,931 R1643L probably damaging Het
F13b G A 1: 139,508,157 E234K probably damaging Het
Fam171a1 T C 2: 3,225,729 I633T probably benign Het
Frem3 A G 8: 80,616,039 I1654V probably benign Het
Galr2 A G 11: 116,283,582 E346G possibly damaging Het
Gck G A 11: 5,949,705 probably benign Het
Gen1 G T 12: 11,241,832 T717K probably benign Het
Gm13083 A T 4: 143,616,165 I281F probably benign Het
Gpatch8 TTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC 11: 102,480,188 probably benign Het
Hat1 A G 2: 71,421,251 T215A possibly damaging Het
Hmbox1 A T 14: 64,897,037 M38K probably damaging Het
Ifi47 A G 11: 49,096,542 K379E probably benign Het
Ift81 T C 5: 122,568,999 Y460C probably damaging Het
Jarid2 T A 13: 44,902,462 S381R probably damaging Het
Kmt2b A T 7: 30,579,963 V1458E probably damaging Het
Kpna4 G T 3: 69,089,933 P336Q probably damaging Het
Krt84 T C 15: 101,532,254 R168G probably damaging Het
Lhx8 T A 3: 154,324,584 Y137F possibly damaging Het
Lin7b T C 7: 45,370,227 E19G probably damaging Het
Lrmda A T 14: 22,584,540 R131S probably damaging Het
Lrrc75b C T 10: 75,553,678 A280T possibly damaging Het
Megf11 G A 9: 64,647,951 R268K probably null Het
Mgat4e G T 1: 134,541,959 Q116K probably damaging Het
Mlkl A G 8: 111,319,403 L325P probably damaging Het
Mup2 A G 4: 60,137,641 L134P probably damaging Het
Myo19 A G 11: 84,900,586 E489G probably damaging Het
Ncbp3 C A 11: 73,048,009 P37Q probably damaging Het
Nf2 A G 11: 4,799,964 V236A probably damaging Het
Nlrp1a A T 11: 71,124,079 M115K possibly damaging Het
Nsf T A 11: 103,828,530 K649* probably null Het
Olfml2b A T 1: 170,666,785 I313L probably benign Het
Olfr316 T A 11: 58,758,283 I206N probably damaging Het
Olfr654 T A 7: 104,588,557 V251D possibly damaging Het
Papln T A 12: 83,776,521 L444Q probably damaging Het
Phc3 T C 3: 30,914,197 I897V probably benign Het
Plcg1 T C 2: 160,754,380 L632P probably damaging Het
Prkg1 T C 19: 31,302,301 T178A probably damaging Het
Ptges T A 2: 30,892,804 T79S probably benign Het
Rab26 T C 17: 24,532,289 T81A probably damaging Het
Rai14 T A 15: 10,595,003 I145L possibly damaging Het
Rasgrf1 A G 9: 90,002,361 T960A possibly damaging Het
Rfx1 A T 8: 84,094,826 I755F probably damaging Het
Rims1 T G 1: 22,432,923 L670F probably damaging Het
Rtkn G A 6: 83,149,711 C297Y probably damaging Het
Sec23a A T 12: 58,989,443 N378K probably benign Het
Slc17a2 A G 13: 23,822,407 E472G probably benign Het
Slc1a2 T C 2: 102,766,995 M449T probably damaging Het
Slc22a3 G A 17: 12,433,631 L369F possibly damaging Het
Smad6 G T 9: 64,021,787 D82E unknown Het
Smgc A T 15: 91,852,608 I463F possibly damaging Het
Strada C A 11: 106,171,039 G166C probably damaging Het
Tcaf3 A G 6: 42,593,891 V309A probably benign Het
Tet2 C T 3: 133,469,591 E1332K possibly damaging Het
Tfcp2l1 A G 1: 118,668,632 N366D probably damaging Het
Tll2 G A 19: 41,117,284 P369L possibly damaging Het
Tox4 T C 14: 52,292,097 V505A probably benign Het
Trbv4 A G 6: 41,059,853 D104G probably damaging Het
Ugdh T C 5: 65,417,037 E416G probably damaging Het
Usp47 T A 7: 112,087,013 C613S probably damaging Het
Vmn1r11 T A 6: 57,138,162 N270K probably benign Het
Wsb2 T A 5: 117,371,095 L147Q probably damaging Het
Xrn1 G A 9: 95,979,145 A453T possibly damaging Het
Zan A G 5: 137,461,844 S1262P unknown Het
Zswim4 A G 8: 84,219,927 L700P probably damaging Het
Other mutations in Ddx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02030:Ddx4 APN 13 112624777 splice site probably benign
IGL02682:Ddx4 APN 13 112622186 missense probably benign 0.04
IGL02729:Ddx4 APN 13 112651412 utr 5 prime probably benign
H8930:Ddx4 UTSW 13 112613833 splice site probably null
R0518:Ddx4 UTSW 13 112624779 critical splice donor site probably null
R0521:Ddx4 UTSW 13 112624779 critical splice donor site probably null
R1527:Ddx4 UTSW 13 112622239 missense possibly damaging 0.95
R1548:Ddx4 UTSW 13 112599997 missense probably damaging 1.00
R1773:Ddx4 UTSW 13 112599902 missense probably benign
R1886:Ddx4 UTSW 13 112622665 missense probably damaging 1.00
R1969:Ddx4 UTSW 13 112600013 missense probably damaging 0.99
R1969:Ddx4 UTSW 13 112620742 missense probably damaging 0.99
R1970:Ddx4 UTSW 13 112600013 missense probably damaging 0.99
R1971:Ddx4 UTSW 13 112600013 missense probably damaging 0.99
R2265:Ddx4 UTSW 13 112621276 missense probably benign 0.08
R2280:Ddx4 UTSW 13 112620656 missense probably benign 0.03
R2846:Ddx4 UTSW 13 112604612 missense probably damaging 0.99
R2906:Ddx4 UTSW 13 112620777 splice site probably benign
R2980:Ddx4 UTSW 13 112612085 missense probably damaging 1.00
R3732:Ddx4 UTSW 13 112611982 missense possibly damaging 0.56
R4085:Ddx4 UTSW 13 112613761 missense probably benign 0.05
R4088:Ddx4 UTSW 13 112613761 missense probably benign 0.05
R4089:Ddx4 UTSW 13 112613761 missense probably benign 0.05
R4090:Ddx4 UTSW 13 112613761 missense probably benign 0.05
R4600:Ddx4 UTSW 13 112612060 missense probably damaging 1.00
R4610:Ddx4 UTSW 13 112612060 missense probably damaging 1.00
R4669:Ddx4 UTSW 13 112622244 missense probably damaging 1.00
R4700:Ddx4 UTSW 13 112613735 missense probably damaging 1.00
R4782:Ddx4 UTSW 13 112613696 critical splice donor site probably null
R4782:Ddx4 UTSW 13 112651360 missense probably benign 0.10
R5326:Ddx4 UTSW 13 112621245 missense probably damaging 1.00
R5542:Ddx4 UTSW 13 112621245 missense probably damaging 1.00
R6111:Ddx4 UTSW 13 112621232 nonsense probably null
R6253:Ddx4 UTSW 13 112636022 nonsense probably null
R6253:Ddx4 UTSW 13 112636023 missense probably benign 0.00
R6286:Ddx4 UTSW 13 112613735 missense probably damaging 1.00
R6518:Ddx4 UTSW 13 112604547 missense probably benign
R6645:Ddx4 UTSW 13 112641174 missense possibly damaging 0.70
R7017:Ddx4 UTSW 13 112601488 missense probably damaging 1.00
R7822:Ddx4 UTSW 13 112612113 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTCGTTTTGTTTCCACAAG -3'
(R):5'- GCAAACAGGTTGAGTCTTGTCC -3'

Sequencing Primer
(F):5'- GGAAAATGCTATTATCCTGTGCG -3'
(R):5'- GGATCTTGCTTCATAAAGTGAC -3'
Posted On2019-06-26