Incidental Mutation 'R7155:Prkg1'
ID 557267
Institutional Source Beutler Lab
Gene Symbol Prkg1
Ensembl Gene ENSMUSG00000052920
Gene Name protein kinase, cGMP-dependent, type I
Synonyms Prkgr1b, Prkg1b
MMRRC Submission 045226-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.454) question?
Stock # R7155 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 30541889-31742433 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 31279701 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 178 (T178A)
Ref Sequence ENSEMBL: ENSMUSP00000067576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065067] [ENSMUST00000073581]
AlphaFold P0C605
Predicted Effect probably damaging
Transcript: ENSMUST00000065067
AA Change: T178A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067576
Gene: ENSMUSG00000052920
AA Change: T178A

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
cNMP 103 216 6.37e-27 SMART
cNMP 221 343 1.23e-33 SMART
S_TKc 360 619 5.25e-91 SMART
S_TK_X 620 671 1.55e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000073581
AA Change: T193A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000073268
Gene: ENSMUSG00000052920
AA Change: T193A

DomainStartEndE-ValueType
coiled coil region 10 62 N/A INTRINSIC
cNMP 118 231 6.37e-27 SMART
cNMP 236 358 1.23e-33 SMART
S_TKc 375 634 5.25e-91 SMART
S_TK_X 635 686 1.55e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammals have three different isoforms of cyclic GMP-dependent protein kinase (Ialpha, Ibeta, and II). These PRKG isoforms act as key mediators of the nitric oxide/cGMP signaling pathway and are important components of many signal transduction processes in diverse cell types. This PRKG1 gene on human chromosome 10 encodes the soluble Ialpha and Ibeta isoforms of PRKG by alternative transcript splicing. A separate gene on human chromosome 4, PRKG2, encodes the membrane-bound PRKG isoform II. The PRKG1 proteins play a central role in regulating cardiovascular and neuronal functions in addition to relaxing smooth muscle tone, preventing platelet aggregation, and modulating cell growth. This gene is most strongly expressed in all types of smooth muscle, platelets, cerebellar Purkinje cells, hippocampal neurons, and the lateral amygdala. Isoforms Ialpha and Ibeta have identical cGMP-binding and catalytic domains but differ in their leucine/isoleucine zipper and autoinhibitory sequences and therefore differ in their dimerization substrates and kinase enzyme activity. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mutant mice exhibit abnormal smooth muscle function and penile erectile deficiency. Conditional disruption in the hippocampus results in impaired LTP. Mice homozygous for a transposon induced allele exhibit postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,315,489 (GRCm39) L63P possibly damaging Het
Abca13 A T 11: 9,479,010 (GRCm39) Y4286F probably benign Het
Aldh5a1 A C 13: 25,095,572 (GRCm39) V515G possibly damaging Het
Ankrd42 T C 7: 92,241,141 (GRCm39) E406G possibly damaging Het
Arfgef2 T A 2: 166,707,733 (GRCm39) M1043K probably benign Het
Arhgef11 T A 3: 87,616,879 (GRCm39) Y383* probably null Het
Aste1 C T 9: 105,282,335 (GRCm39) P614L probably damaging Het
B3galt5 T A 16: 96,117,005 (GRCm39) S213T probably damaging Het
Bak1 A G 17: 27,241,434 (GRCm39) L108P possibly damaging Het
Bcl6 G A 16: 23,784,976 (GRCm39) R675* probably null Het
Bdp1 T G 13: 100,197,659 (GRCm39) T909P possibly damaging Het
Cacna1i A G 15: 80,279,439 (GRCm39) H2060R probably benign Het
Cdhr3 G T 12: 33,111,772 (GRCm39) P246Q probably damaging Het
Colgalt1 T C 8: 72,076,354 (GRCm39) S602P probably damaging Het
Csde1 T C 3: 102,947,269 (GRCm39) S74P probably damaging Het
Cyp51 A T 5: 4,137,846 (GRCm39) C366S possibly damaging Het
Dcaf7 A G 11: 105,928,016 (GRCm39) N23D probably damaging Het
Ddx10 G A 9: 53,028,588 (GRCm39) A772V probably benign Het
Ddx4 A G 13: 112,750,319 (GRCm39) F404S probably benign Het
Dlg4 T A 11: 69,908,042 (GRCm39) M1K probably null Het
Dnajc6 T C 4: 101,470,142 (GRCm39) V293A probably damaging Het
Etl4 G T 2: 20,811,742 (GRCm39) R1643L probably damaging Het
F13b G A 1: 139,435,895 (GRCm39) E234K probably damaging Het
Fam171a1 T C 2: 3,226,766 (GRCm39) I633T probably benign Het
Frem3 A G 8: 81,342,668 (GRCm39) I1654V probably benign Het
Galr2 A G 11: 116,174,408 (GRCm39) E346G possibly damaging Het
Gck G A 11: 5,899,705 (GRCm39) probably benign Het
Gen1 G T 12: 11,291,833 (GRCm39) T717K probably benign Het
Gpatch8 TTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC 11: 102,371,014 (GRCm39) probably benign Het
Hat1 A G 2: 71,251,595 (GRCm39) T215A possibly damaging Het
Hmbox1 A T 14: 65,134,486 (GRCm39) M38K probably damaging Het
Ifi47 A G 11: 48,987,369 (GRCm39) K379E probably benign Het
Ift81 T C 5: 122,707,062 (GRCm39) Y460C probably damaging Het
Jarid2 T A 13: 45,055,938 (GRCm39) S381R probably damaging Het
Kmt2b A T 7: 30,279,388 (GRCm39) V1458E probably damaging Het
Kpna4 G T 3: 68,997,266 (GRCm39) P336Q probably damaging Het
Krt84 T C 15: 101,440,689 (GRCm39) R168G probably damaging Het
Lhx8 T A 3: 154,030,221 (GRCm39) Y137F possibly damaging Het
Lin7b T C 7: 45,019,651 (GRCm39) E19G probably damaging Het
Lrmda A T 14: 22,634,608 (GRCm39) R131S probably damaging Het
Lrrc75b C T 10: 75,389,512 (GRCm39) A280T possibly damaging Het
Megf11 G A 9: 64,555,233 (GRCm39) R268K probably null Het
Mgat4e G T 1: 134,469,697 (GRCm39) Q116K probably damaging Het
Mlkl A G 8: 112,046,035 (GRCm39) L325P probably damaging Het
Mup2 A G 4: 60,137,641 (GRCm39) L134P probably damaging Het
Myo19 A G 11: 84,791,412 (GRCm39) E489G probably damaging Het
Ncbp3 C A 11: 72,938,835 (GRCm39) P37Q probably damaging Het
Nf2 A G 11: 4,749,964 (GRCm39) V236A probably damaging Het
Nlrp1a A T 11: 71,014,905 (GRCm39) M115K possibly damaging Het
Nsf T A 11: 103,719,356 (GRCm39) K649* probably null Het
Olfml2b A T 1: 170,494,354 (GRCm39) I313L probably benign Het
Or2ak4 T A 11: 58,649,109 (GRCm39) I206N probably damaging Het
Or52u1 T A 7: 104,237,764 (GRCm39) V251D possibly damaging Het
Papln T A 12: 83,823,295 (GRCm39) L444Q probably damaging Het
Phc3 T C 3: 30,968,346 (GRCm39) I897V probably benign Het
Plcg1 T C 2: 160,596,300 (GRCm39) L632P probably damaging Het
Pramel21 A T 4: 143,342,735 (GRCm39) I281F probably benign Het
Ptges T A 2: 30,782,816 (GRCm39) T79S probably benign Het
Rab26 T C 17: 24,751,263 (GRCm39) T81A probably damaging Het
Rai14 T A 15: 10,595,089 (GRCm39) I145L possibly damaging Het
Rasgrf1 A G 9: 89,884,414 (GRCm39) T960A possibly damaging Het
Rfx1 A T 8: 84,821,455 (GRCm39) I755F probably damaging Het
Rims1 T G 1: 22,503,174 (GRCm39) L670F probably damaging Het
Rtkn G A 6: 83,126,692 (GRCm39) C297Y probably damaging Het
Sec23a A T 12: 59,036,229 (GRCm39) N378K probably benign Het
Slc1a2 T C 2: 102,597,340 (GRCm39) M449T probably damaging Het
Slc22a3 G A 17: 12,652,518 (GRCm39) L369F possibly damaging Het
Slc34a1 A G 13: 24,006,390 (GRCm39) E472G probably benign Het
Slc49a4 G T 16: 35,555,947 (GRCm39) T171K probably benign Het
Smad6 G T 9: 63,929,069 (GRCm39) D82E unknown Het
Smgc A T 15: 91,736,811 (GRCm39) I463F possibly damaging Het
Strada C A 11: 106,061,865 (GRCm39) G166C probably damaging Het
Tcaf3 A G 6: 42,570,825 (GRCm39) V309A probably benign Het
Tet2 C T 3: 133,175,352 (GRCm39) E1332K possibly damaging Het
Tfcp2l1 A G 1: 118,596,362 (GRCm39) N366D probably damaging Het
Tll2 G A 19: 41,105,723 (GRCm39) P369L possibly damaging Het
Tox4 T C 14: 52,529,554 (GRCm39) V505A probably benign Het
Trbv4 A G 6: 41,036,787 (GRCm39) D104G probably damaging Het
Ugdh T C 5: 65,574,380 (GRCm39) E416G probably damaging Het
Usp47 T A 7: 111,686,220 (GRCm39) C613S probably damaging Het
Vmn1r11 T A 6: 57,115,147 (GRCm39) N270K probably benign Het
Wsb2 T A 5: 117,509,160 (GRCm39) L147Q probably damaging Het
Xrn1 G A 9: 95,861,198 (GRCm39) A453T possibly damaging Het
Zan A G 5: 137,460,106 (GRCm39) S1262P unknown Het
Zswim4 A G 8: 84,946,556 (GRCm39) L700P probably damaging Het
Other mutations in Prkg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Prkg1 APN 19 31,279,740 (GRCm39) missense probably benign 0.02
IGL00481:Prkg1 APN 19 30,549,022 (GRCm39) missense probably benign 0.28
IGL00517:Prkg1 APN 19 30,872,068 (GRCm39) missense probably benign
IGL00782:Prkg1 APN 19 30,556,153 (GRCm39) splice site probably benign
IGL01070:Prkg1 APN 19 30,546,743 (GRCm39) splice site probably benign
IGL01106:Prkg1 APN 19 30,562,678 (GRCm39) missense probably benign 0.05
IGL01783:Prkg1 APN 19 30,602,089 (GRCm39) missense probably damaging 1.00
IGL02135:Prkg1 APN 19 30,970,476 (GRCm39) missense probably benign 0.13
IGL02492:Prkg1 APN 19 30,701,602 (GRCm39) missense probably damaging 1.00
IGL02543:Prkg1 APN 19 30,602,134 (GRCm39) missense possibly damaging 0.62
IGL02733:Prkg1 APN 19 31,279,701 (GRCm39) missense probably damaging 1.00
IGL03129:Prkg1 APN 19 30,562,681 (GRCm39) nonsense probably null
IGL03220:Prkg1 APN 19 30,546,637 (GRCm39) utr 3 prime probably benign
R0363:Prkg1 UTSW 19 31,641,596 (GRCm39) missense probably damaging 1.00
R0693:Prkg1 UTSW 19 30,572,378 (GRCm39) missense probably benign
R1099:Prkg1 UTSW 19 30,549,012 (GRCm39) missense probably benign
R1464:Prkg1 UTSW 19 30,556,270 (GRCm39) missense probably damaging 0.99
R1464:Prkg1 UTSW 19 30,556,270 (GRCm39) missense probably damaging 0.99
R1556:Prkg1 UTSW 19 30,602,143 (GRCm39) missense probably benign
R1738:Prkg1 UTSW 19 30,764,322 (GRCm39) missense possibly damaging 0.48
R1974:Prkg1 UTSW 19 31,563,095 (GRCm39) missense probably damaging 1.00
R2011:Prkg1 UTSW 19 31,641,542 (GRCm39) missense possibly damaging 0.94
R2207:Prkg1 UTSW 19 30,556,260 (GRCm39) missense probably damaging 1.00
R2270:Prkg1 UTSW 19 30,556,031 (GRCm39) missense probably benign 0.27
R3009:Prkg1 UTSW 19 31,641,512 (GRCm39) missense possibly damaging 0.74
R4078:Prkg1 UTSW 19 31,562,978 (GRCm39) missense probably damaging 1.00
R4355:Prkg1 UTSW 19 30,546,629 (GRCm39) utr 3 prime probably benign
R4652:Prkg1 UTSW 19 30,572,412 (GRCm39) missense probably damaging 1.00
R4669:Prkg1 UTSW 19 31,641,639 (GRCm39) missense probably damaging 0.98
R4684:Prkg1 UTSW 19 31,641,579 (GRCm39) nonsense probably null
R4789:Prkg1 UTSW 19 31,563,045 (GRCm39) missense probably damaging 0.97
R4826:Prkg1 UTSW 19 31,742,006 (GRCm39) missense possibly damaging 0.93
R4936:Prkg1 UTSW 19 30,563,775 (GRCm39) missense probably benign 0.37
R5625:Prkg1 UTSW 19 31,742,162 (GRCm39) missense possibly damaging 0.95
R5819:Prkg1 UTSW 19 31,563,072 (GRCm39) missense probably benign 0.02
R5855:Prkg1 UTSW 19 30,872,094 (GRCm39) missense possibly damaging 0.93
R5882:Prkg1 UTSW 19 31,563,097 (GRCm39) missense probably damaging 1.00
R5965:Prkg1 UTSW 19 30,701,556 (GRCm39) splice site probably null
R5968:Prkg1 UTSW 19 30,570,324 (GRCm39) missense probably damaging 1.00
R6310:Prkg1 UTSW 19 30,546,651 (GRCm39) missense probably damaging 1.00
R6433:Prkg1 UTSW 19 30,758,746 (GRCm39) missense probably benign 0.21
R6702:Prkg1 UTSW 19 30,970,484 (GRCm39) missense probably benign 0.00
R6750:Prkg1 UTSW 19 31,741,961 (GRCm39) missense probably benign 0.41
R6894:Prkg1 UTSW 19 30,602,174 (GRCm39) nonsense probably null
R7165:Prkg1 UTSW 19 30,562,599 (GRCm39) missense probably damaging 1.00
R7238:Prkg1 UTSW 19 30,602,090 (GRCm39) missense probably damaging 1.00
R7428:Prkg1 UTSW 19 30,556,235 (GRCm39) missense probably damaging 1.00
R7748:Prkg1 UTSW 19 30,970,491 (GRCm39) missense possibly damaging 0.90
R7804:Prkg1 UTSW 19 30,602,170 (GRCm39) missense possibly damaging 0.92
R7804:Prkg1 UTSW 19 30,556,032 (GRCm39) missense probably benign 0.00
R7893:Prkg1 UTSW 19 30,563,767 (GRCm39) missense probably damaging 0.99
R8304:Prkg1 UTSW 19 30,701,584 (GRCm39) missense possibly damaging 0.75
R8497:Prkg1 UTSW 19 31,279,709 (GRCm39) missense probably damaging 1.00
R8676:Prkg1 UTSW 19 31,742,146 (GRCm39) missense probably damaging 0.98
R9318:Prkg1 UTSW 19 30,549,038 (GRCm39) missense probably benign 0.09
R9694:Prkg1 UTSW 19 30,764,371 (GRCm39) missense possibly damaging 0.84
X0011:Prkg1 UTSW 19 30,970,521 (GRCm39) missense probably damaging 1.00
Z1177:Prkg1 UTSW 19 31,279,773 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTACAATAATTAGGCCATGTCAGAG -3'
(R):5'- GCTCGTAATGAAGCTGCAGC -3'

Sequencing Primer
(F):5'- ATCATCTTAGAGTACGAAGGCC -3'
(R):5'- CTCGTAATGAAGCTGCAGCAAATG -3'
Posted On 2019-06-26