Mutagenetix > Incidental Mutation

Incidental Mutation 'R7155:Tll2'

557268

Institutional Source

Beutler Lab

Gene Symbol

Tll2

Ensembl Gene

ENSMUSG00000025013

Gene Name

tolloid-like 2

Synonyms

MMRRC Submission

045226-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.738) question?

Stock #

R7155 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

41083981-41206774 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 41117284 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 369 (P369L)

Ref Sequence

ENSEMBL: ENSMUSP00000025986 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025986] [ENSMUST00000169941]

AlphaFold

Q9WVM6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025986
AA Change: P369L

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000025986
Gene: ENSMUSG00000025013
AA Change: P369L

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
ZnMc	152	294	1.15e-54	SMART
CUB	348	460	7.69e-44	SMART
CUB	461	573	8.69e-52	SMART
EGF_CA	573	614	1.26e-11	SMART
CUB	617	729	3.99e-51	SMART
EGF_CA	729	769	5.92e-8	SMART
CUB	773	885	3.08e-43	SMART
CUB	886	1002	2.25e-36	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169941
AA Change: P352L

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000125973
Gene: ENSMUSG00000025013
AA Change: P352L

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
ZnMc	152	294	1.15e-54	SMART
CUB	331	443	7.69e-44	SMART
CUB	444	556	8.69e-52	SMART
EGF_CA	556	597	1.26e-11	SMART
CUB	600	712	3.99e-51	SMART
EGF_CA	712	752	5.92e-8	SMART
CUB	756	868	3.08e-43	SMART
CUB	869	985	2.25e-36	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. Unlike other family members, a similar protein in mice does not cleave procollagen C-propeptides or chordin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in increased muscle weight. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	A	G	2: 151,473,569	L63P	possibly damaging	Het
Abca13	A	T	11: 9,529,010	Y4286F	probably benign	Het
Aldh5a1	A	C	13: 24,911,589	V515G	possibly damaging	Het
Ankrd42	T	C	7: 92,591,933	E406G	possibly damaging	Het
Arfgef2	T	A	2: 166,865,813	M1043K	probably benign	Het
Arhgef11	T	A	3: 87,709,572	Y383*	probably null	Het
Aste1	C	T	9: 105,405,136	P614L	probably damaging	Het
B3galt5	T	A	16: 96,315,805	S213T	probably damaging	Het
Bak1	A	G	17: 27,022,460	L108P	possibly damaging	Het
Bcl6	G	A	16: 23,966,226	R675*	probably null	Het
Bdp1	T	G	13: 100,061,151	T909P	possibly damaging	Het
Cacna1i	A	G	15: 80,395,238	H2060R	probably benign	Het
Cdhr3	G	T	12: 33,061,773	P246Q	probably damaging	Het
Colgalt1	T	C	8: 71,623,710	S602P	probably damaging	Het
Csde1	T	C	3: 103,039,953	S74P	probably damaging	Het
Cyp51	A	T	5: 4,087,846	C366S	possibly damaging	Het
Dcaf7	A	G	11: 106,037,190	N23D	probably damaging	Het
Ddx10	G	A	9: 53,117,288	A772V	probably benign	Het
Ddx4	A	G	13: 112,613,785	F404S	probably benign	Het
Dirc2	G	T	16: 35,735,577	T171K	probably benign	Het
Dlg4	T	A	11: 70,017,216	M1K	probably null	Het
Dnajc6	T	C	4: 101,612,945	V293A	probably damaging	Het
Etl4	G	T	2: 20,806,931	R1643L	probably damaging	Het
F13b	G	A	1: 139,508,157	E234K	probably damaging	Het
Fam171a1	T	C	2: 3,225,729	I633T	probably benign	Het
Frem3	A	G	8: 80,616,039	I1654V	probably benign	Het
Galr2	A	G	11: 116,283,582	E346G	possibly damaging	Het
Gck	G	A	11: 5,949,705		probably benign	Het
Gen1	G	T	12: 11,241,832	T717K	probably benign	Het
Gm13083	A	T	4: 143,616,165	I281F	probably benign	Het
Gpatch8	TTCCTCCTCCTCCTCTTCCTCCTCCTC	TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC	11: 102,480,188		probably benign	Het
Hat1	A	G	2: 71,421,251	T215A	possibly damaging	Het
Hmbox1	A	T	14: 64,897,037	M38K	probably damaging	Het
Ifi47	A	G	11: 49,096,542	K379E	probably benign	Het
Ift81	T	C	5: 122,568,999	Y460C	probably damaging	Het
Jarid2	T	A	13: 44,902,462	S381R	probably damaging	Het
Kmt2b	A	T	7: 30,579,963	V1458E	probably damaging	Het
Kpna4	G	T	3: 69,089,933	P336Q	probably damaging	Het
Krt84	T	C	15: 101,532,254	R168G	probably damaging	Het
Lhx8	T	A	3: 154,324,584	Y137F	possibly damaging	Het
Lin7b	T	C	7: 45,370,227	E19G	probably damaging	Het
Lrmda	A	T	14: 22,584,540	R131S	probably damaging	Het
Lrrc75b	C	T	10: 75,553,678	A280T	possibly damaging	Het
Megf11	G	A	9: 64,647,951	R268K	probably null	Het
Mgat4e	G	T	1: 134,541,959	Q116K	probably damaging	Het
Mlkl	A	G	8: 111,319,403	L325P	probably damaging	Het
Mup2	A	G	4: 60,137,641	L134P	probably damaging	Het
Myo19	A	G	11: 84,900,586	E489G	probably damaging	Het
Ncbp3	C	A	11: 73,048,009	P37Q	probably damaging	Het
Nf2	A	G	11: 4,799,964	V236A	probably damaging	Het
Nlrp1a	A	T	11: 71,124,079	M115K	possibly damaging	Het
Nsf	T	A	11: 103,828,530	K649*	probably null	Het
Olfml2b	A	T	1: 170,666,785	I313L	probably benign	Het
Olfr316	T	A	11: 58,758,283	I206N	probably damaging	Het
Olfr654	T	A	7: 104,588,557	V251D	possibly damaging	Het
Papln	T	A	12: 83,776,521	L444Q	probably damaging	Het
Phc3	T	C	3: 30,914,197	I897V	probably benign	Het
Plcg1	T	C	2: 160,754,380	L632P	probably damaging	Het
Prkg1	T	C	19: 31,302,301	T178A	probably damaging	Het
Ptges	T	A	2: 30,892,804	T79S	probably benign	Het
Rab26	T	C	17: 24,532,289	T81A	probably damaging	Het
Rai14	T	A	15: 10,595,003	I145L	possibly damaging	Het
Rasgrf1	A	G	9: 90,002,361	T960A	possibly damaging	Het
Rfx1	A	T	8: 84,094,826	I755F	probably damaging	Het
Rims1	T	G	1: 22,432,923	L670F	probably damaging	Het
Rtkn	G	A	6: 83,149,711	C297Y	probably damaging	Het
Sec23a	A	T	12: 58,989,443	N378K	probably benign	Het
Slc17a2	A	G	13: 23,822,407	E472G	probably benign	Het
Slc1a2	T	C	2: 102,766,995	M449T	probably damaging	Het
Slc22a3	G	A	17: 12,433,631	L369F	possibly damaging	Het
Smad6	G	T	9: 64,021,787	D82E	unknown	Het
Smgc	A	T	15: 91,852,608	I463F	possibly damaging	Het
Strada	C	A	11: 106,171,039	G166C	probably damaging	Het
Tcaf3	A	G	6: 42,593,891	V309A	probably benign	Het
Tet2	C	T	3: 133,469,591	E1332K	possibly damaging	Het
Tfcp2l1	A	G	1: 118,668,632	N366D	probably damaging	Het
Tox4	T	C	14: 52,292,097	V505A	probably benign	Het
Trbv4	A	G	6: 41,059,853	D104G	probably damaging	Het
Ugdh	T	C	5: 65,417,037	E416G	probably damaging	Het
Usp47	T	A	7: 112,087,013	C613S	probably damaging	Het
Vmn1r11	T	A	6: 57,138,162	N270K	probably benign	Het
Wsb2	T	A	5: 117,371,095	L147Q	probably damaging	Het
Xrn1	G	A	9: 95,979,145	A453T	possibly damaging	Het
Zan	A	G	5: 137,461,844	S1262P	unknown	Het
Zswim4	A	G	8: 84,219,927	L700P	probably damaging	Het

Other mutations in Tll2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01555:Tll2	APN	19	41086366	missense	probably benign	0.01
IGL02028:Tll2	APN	19	41098649	nonsense	probably null
IGL02146:Tll2	APN	19	41097837	missense	probably benign	0.00
IGL02192:Tll2	APN	19	41086263	missense	possibly damaging	0.73
IGL02544:Tll2	APN	19	41135965	missense	probably damaging	1.00
PIT4677001:Tll2	UTSW	19	41130558	missense	probably benign	0.14
R0141:Tll2	UTSW	19	41097912	missense	probably damaging	1.00
R0372:Tll2	UTSW	19	41183313	critical splice acceptor site	probably null
R0393:Tll2	UTSW	19	41088826	missense	possibly damaging	0.95
R0402:Tll2	UTSW	19	41098693	missense	possibly damaging	0.56
R0613:Tll2	UTSW	19	41104990	missense	probably damaging	0.97
R0756:Tll2	UTSW	19	41120228	missense	probably damaging	1.00
R0757:Tll2	UTSW	19	41120228	missense	probably damaging	1.00
R0790:Tll2	UTSW	19	41103850	missense	probably damaging	0.98
R0834:Tll2	UTSW	19	41113073	missense	probably damaging	1.00
R0843:Tll2	UTSW	19	41128463	splice site	probably null
R1014:Tll2	UTSW	19	41103851	missense	probably damaging	1.00
R1178:Tll2	UTSW	19	41092847	missense	probably damaging	1.00
R1233:Tll2	UTSW	19	41095984	missense	possibly damaging	0.79
R1364:Tll2	UTSW	19	41120228	missense	probably damaging	1.00
R1367:Tll2	UTSW	19	41120228	missense	probably damaging	1.00
R1368:Tll2	UTSW	19	41120228	missense	probably damaging	1.00
R1519:Tll2	UTSW	19	41086400	missense	probably benign	0.17
R1894:Tll2	UTSW	19	41088671	critical splice donor site	probably null
R1896:Tll2	UTSW	19	41113059	missense	probably benign	0.44
R1917:Tll2	UTSW	19	41128497	missense	possibly damaging	0.83
R2170:Tll2	UTSW	19	41183275	missense	probably damaging	1.00
R4433:Tll2	UTSW	19	41121348	missense	probably benign	0.03
R4617:Tll2	UTSW	19	41098636	missense	probably benign	0.31
R4831:Tll2	UTSW	19	41130512	missense	probably damaging	1.00
R5057:Tll2	UTSW	19	41117266	missense	probably benign	0.02
R5119:Tll2	UTSW	19	41130509	missense	possibly damaging	0.48
R5194:Tll2	UTSW	19	41095897	missense	probably damaging	1.00
R5280:Tll2	UTSW	19	41117257	missense	possibly damaging	0.87
R5602:Tll2	UTSW	19	41104981	missense	possibly damaging	0.63
R5800:Tll2	UTSW	19	41104934	missense	probably benign	0.10
R6223:Tll2	UTSW	19	41135952	missense	possibly damaging	0.54
R7047:Tll2	UTSW	19	41086240	missense	probably damaging	0.99
R7213:Tll2	UTSW	19	41120227	missense	probably damaging	0.97
R7231:Tll2	UTSW	19	41086234	missense	probably benign	0.02
R7390:Tll2	UTSW	19	41120169	critical splice donor site	probably null
R7414:Tll2	UTSW	19	41103829	missense	probably damaging	0.98
R7757:Tll2	UTSW	19	41096008	missense	probably damaging	1.00
R8165:Tll2	UTSW	19	41088874	missense	possibly damaging	0.79
R8418:Tll2	UTSW	19	41092837	missense	probably damaging	1.00
R8788:Tll2	UTSW	19	41121375	missense	probably benign	0.00
R8811:Tll2	UTSW	19	41206573	missense	probably benign
R9227:Tll2	UTSW	19	41104997	missense	probably benign	0.34
R9230:Tll2	UTSW	19	41104997	missense	probably benign	0.34
R9280:Tll2	UTSW	19	41088870	missense	possibly damaging	0.83
R9282:Tll2	UTSW	19	41086333	missense	probably benign
R9382:Tll2	UTSW	19	41128558	missense	probably benign	0.04
R9715:Tll2	UTSW	19	41103799	missense	probably damaging	0.99
R9760:Tll2	UTSW	19	41130645	missense	probably damaging	1.00
R9801:Tll2	UTSW	19	41206554	missense	probably benign
X0027:Tll2	UTSW	19	41183303	missense	probably damaging	1.00
Z1177:Tll2	UTSW	19	41092734	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- ATTAACTGCACAAGGGTTGGGTC -3'
(R):5'- AAGGCTTTCACTTCACAGGC -3'

Sequencing Primer
(F):5'- CAGGGTGTCATGCTATTCCCG -3'
(R):5'- TGTGCCTGCATCAGAGTT -3'

Posted On

2019-06-26