Incidental Mutation 'R7156:Gm597'
ID557269
Institutional Source Beutler Lab
Gene Symbol Gm597
Ensembl Gene ENSMUSG00000048411
Gene Namepredicted gene 597
SynonymsLOC210962
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R7156 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location28776117-28780252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28776767 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 728 (M728K)
Ref Sequence ENSEMBL: ENSMUSP00000058140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059937]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059937
AA Change: M728K

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000058140
Gene: ENSMUSG00000048411
AA Change: M728K

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 112 129 N/A INTRINSIC
Pfam:FAM75 137 472 8.1e-14 PFAM
low complexity region 664 675 N/A INTRINSIC
internal_repeat_1 718 807 1.4e-5 PROSPERO
internal_repeat_1 807 894 1.4e-5 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (81/81)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik T C 7: 40,993,858 I317T possibly damaging Het
4931406P16Rik G T 7: 34,245,708 N582K possibly damaging Het
4931409K22Rik C T 5: 24,552,650 E150K probably benign Het
Acsl5 G A 19: 55,268,828 probably null Het
Ahrr G A 13: 74,229,916 T136I probably damaging Het
AI597479 G A 1: 43,111,101 D124N probably damaging Het
Arap2 G T 5: 62,604,571 A1604D probably damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Cadps2 T C 6: 23,688,956 N118S probably benign Het
Caskin1 T A 17: 24,500,683 probably null Het
Cc2d1a C T 8: 84,135,760 V684M possibly damaging Het
Ccdc91 T C 6: 147,534,178 S87P possibly damaging Het
Cdr2l A G 11: 115,390,966 Q99R probably benign Het
Celsr3 T C 9: 108,838,004 L2066P possibly damaging Het
Cep95 A C 11: 106,809,224 L313F possibly damaging Het
Chst10 G A 1: 38,874,007 T63M probably damaging Het
Clrn2 G A 5: 45,453,916 G36R probably damaging Het
Cnn2 T G 10: 79,994,515 Y273* probably null Het
Crtap T C 9: 114,378,096 T365A probably benign Het
D630045J12Rik T C 6: 38,195,029 T735A possibly damaging Het
Disp2 C T 2: 118,791,811 A1008V probably damaging Het
Dmrt3 A G 19: 25,610,953 D52G probably damaging Het
Dmrta1 T G 4: 89,688,463 L52R probably damaging Het
Dmrta2 A G 4: 109,981,988 T311A probably damaging Het
Dnm1 T A 2: 32,340,467 N112Y probably damaging Het
Dysf T C 6: 84,087,876 probably null Het
Ep400 A G 5: 110,685,363 F2034L unknown Het
F12 G A 13: 55,418,497 A494V probably damaging Het
Fbp2 A T 13: 62,841,861 F210L probably benign Het
Fbxo31 T A 8: 121,554,321 Q362L possibly damaging Het
Fkbp4 C T 6: 128,435,824 A95T probably benign Het
Frmd6 T G 12: 70,877,209 C80W probably damaging Het
Fsip2 A G 2: 82,982,741 I3135V probably benign Het
Guca2b T A 4: 119,657,690 E34V probably damaging Het
Hdlbp G A 1: 93,413,915 T974I probably damaging Het
Hsdl2 T A 4: 59,617,653 M460K possibly damaging Het
Ift172 C T 5: 31,272,075 V581M probably damaging Het
Ift74 A G 4: 94,660,952 K313R possibly damaging Het
Ints4 T A 7: 97,535,286 probably null Het
Kif21b A C 1: 136,147,824 T230P probably damaging Het
Kit A T 5: 75,615,374 Y272F probably benign Het
Krt77 G A 15: 101,865,496 T241M probably benign Het
Lce1j T A 3: 92,789,184 S96C unknown Het
Marveld3 T A 8: 109,948,188 D332V probably damaging Het
Matr3 G T 18: 35,572,921 V300F probably damaging Het
Mical1 T A 10: 41,485,257 probably null Het
Mslnl T A 17: 25,743,210 V194E probably benign Het
Mug1 C A 6: 121,880,905 T1119K probably damaging Het
Mug1 C T 6: 121,884,343 P1308S probably damaging Het
Neb C A 2: 52,305,283 probably null Het
Neo1 T A 9: 58,902,923 T1082S probably damaging Het
Nkx6-2 C T 7: 139,582,129 probably null Het
Olfr1065 T A 2: 86,445,308 I225L probably damaging Het
Olfr981 T C 9: 40,023,230 I279T probably benign Het
Orc1 A T 4: 108,595,459 E177V probably benign Het
Parp1 G A 1: 180,599,064 V924I possibly damaging Het
Pax2 A T 19: 44,788,859 I165F probably benign Het
Pnma2 C T 14: 66,916,531 P135S probably benign Het
Ranbp17 A G 11: 33,297,420 I718T probably damaging Het
Rbm25 T A 12: 83,664,191 D359E unknown Het
Rgs3 T C 4: 62,617,126 L194P probably damaging Het
Serpinb6b A G 13: 32,971,615 I104V probably benign Het
Smg9 A G 7: 24,420,861 D420G probably benign Het
Smpd1 C T 7: 105,554,486 probably benign Het
Snx17 T A 5: 31,197,348 M318K probably damaging Het
Stard10 G A 7: 101,346,051 D337N probably damaging Het
Tex14 A G 11: 87,484,719 T103A probably damaging Het
Tle1 A G 4: 72,170,716 S97P probably benign Het
Tnfrsf8 T A 4: 145,315,084 M1L unknown Het
Traf3ip2 T C 10: 39,626,177 L107P possibly damaging Het
Trpc7 A T 13: 56,789,766 S626T possibly damaging Het
Ubl7 T A 9: 57,929,756 I350N probably damaging Het
Ubr3 T A 2: 70,021,623 I1878N probably damaging Het
Usp24 G T 4: 106,387,919 probably null Het
Vcan A T 13: 89,689,110 S2772T possibly damaging Het
Vmn2r79 T C 7: 87,037,643 V744A probably damaging Het
Wbp2nl T C 15: 82,305,702 S32P probably damaging Het
Wwc1 A G 11: 35,897,374 probably null Het
Zfp629 C T 7: 127,612,291 W115* probably null Het
Other mutations in Gm597
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Gm597 APN 1 28778651 missense possibly damaging 0.94
IGL00885:Gm597 APN 1 28776845 missense unknown
IGL01296:Gm597 APN 1 28777056 missense probably benign 0.23
IGL01476:Gm597 APN 1 28777453 missense probably benign 0.04
IGL02125:Gm597 APN 1 28776338 missense possibly damaging 0.91
IGL02410:Gm597 APN 1 28778631 missense probably benign 0.25
IGL02982:Gm597 APN 1 28778054 missense probably damaging 1.00
IGL03031:Gm597 APN 1 28778583 missense probably benign 0.03
IGL03267:Gm597 APN 1 28777121 missense probably damaging 1.00
R0294:Gm597 UTSW 1 28778663 missense probably benign 0.00
R0433:Gm597 UTSW 1 28777342 nonsense probably null
R0485:Gm597 UTSW 1 28778142 missense probably damaging 1.00
R0645:Gm597 UTSW 1 28776930 missense probably damaging 0.99
R0744:Gm597 UTSW 1 28777821 missense possibly damaging 0.46
R0836:Gm597 UTSW 1 28777821 missense possibly damaging 0.46
R1036:Gm597 UTSW 1 28777802 missense probably benign 0.01
R1302:Gm597 UTSW 1 28776340 missense probably benign 0.00
R1394:Gm597 UTSW 1 28776809 missense possibly damaging 0.61
R1395:Gm597 UTSW 1 28776809 missense possibly damaging 0.61
R1514:Gm597 UTSW 1 28778748 missense possibly damaging 0.83
R1535:Gm597 UTSW 1 28777424 missense probably damaging 1.00
R2004:Gm597 UTSW 1 28777179 missense probably damaging 1.00
R2021:Gm597 UTSW 1 28778153 missense probably damaging 0.98
R2022:Gm597 UTSW 1 28778153 missense probably damaging 0.98
R3115:Gm597 UTSW 1 28776329 missense possibly damaging 0.92
R3615:Gm597 UTSW 1 28776575 missense probably benign 0.26
R3616:Gm597 UTSW 1 28776575 missense probably benign 0.26
R3862:Gm597 UTSW 1 28777641 missense probably damaging 0.98
R4067:Gm597 UTSW 1 28777631 missense probably damaging 0.98
R4119:Gm597 UTSW 1 28777973 missense probably damaging 0.99
R4415:Gm597 UTSW 1 28777133 missense probably benign 0.01
R5010:Gm597 UTSW 1 28777862 missense possibly damaging 0.52
R5109:Gm597 UTSW 1 28777555 missense possibly damaging 0.46
R5122:Gm597 UTSW 1 28780060 missense probably benign 0.00
R5533:Gm597 UTSW 1 28778082 missense probably damaging 1.00
R6085:Gm597 UTSW 1 28778227 missense possibly damaging 0.55
R6116:Gm597 UTSW 1 28778699 missense probably benign 0.01
R6750:Gm597 UTSW 1 28777414 missense probably damaging 0.98
R6757:Gm597 UTSW 1 28780110 missense probably damaging 0.98
R6774:Gm597 UTSW 1 28776893 missense probably benign 0.00
R7365:Gm597 UTSW 1 28780152 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CGGACTGCTGCTTGTTACCATC -3'
(R):5'- AGCCCTCATTAATGCTCTGG -3'

Sequencing Primer
(F):5'- CTCCTCTGTAACTACAAGGATAGTC -3'
(R):5'- ATTAATGCTCTGGCTCAGAACCTGG -3'
Posted On2019-06-26