Incidental Mutation 'R7156:Kif21b'
ID557273
Institutional Source Beutler Lab
Gene Symbol Kif21b
Ensembl Gene ENSMUSG00000041642
Gene Namekinesin family member 21B
SynonymsN-5 kinesin, 2610511N21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R7156 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location136131389-136177998 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 136147824 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 230 (T230P)
Ref Sequence ENSEMBL: ENSMUSP00000074661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075164] [ENSMUST00000130864]
Predicted Effect probably damaging
Transcript: ENSMUST00000075164
AA Change: T230P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074661
Gene: ENSMUSG00000041642
AA Change: T230P

DomainStartEndE-ValueType
KISc 6 379 6.39e-159 SMART
Blast:KISc 469 543 1e-14 BLAST
low complexity region 578 628 N/A INTRINSIC
coiled coil region 632 825 N/A INTRINSIC
low complexity region 847 866 N/A INTRINSIC
coiled coil region 931 991 N/A INTRINSIC
low complexity region 1109 1123 N/A INTRINSIC
low complexity region 1239 1249 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
WD40 1299 1336 2.89e-5 SMART
WD40 1339 1377 5.69e-4 SMART
WD40 1404 1441 6.42e-1 SMART
WD40 1444 1486 1.5e-3 SMART
WD40 1494 1532 4.8e-2 SMART
WD40 1535 1575 1.55e-5 SMART
WD40 1578 1615 3.81e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130864
AA Change: T230P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114297
Gene: ENSMUSG00000041642
AA Change: T230P

DomainStartEndE-ValueType
KISc 6 379 6.39e-159 SMART
Blast:KISc 469 543 1e-14 BLAST
low complexity region 578 628 N/A INTRINSIC
coiled coil region 632 825 N/A INTRINSIC
low complexity region 847 866 N/A INTRINSIC
coiled coil region 931 991 N/A INTRINSIC
low complexity region 1109 1123 N/A INTRINSIC
low complexity region 1239 1249 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
WD40 1299 1336 2.89e-5 SMART
WD40 1339 1377 5.69e-4 SMART
WD40 1404 1441 6.42e-1 SMART
WD40 1444 1486 1.5e-3 SMART
WD40 1494 1532 4.8e-2 SMART
WD40 1535 1575 1.55e-5 SMART
WD40 1578 1615 5.1e-6 SMART
Meta Mutation Damage Score 0.9043 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin superfamily. Kinesins are ATP-dependent microtubule-based motor proteins that are involved in the intracellular transport of membranous organelles. Single nucleotide polymorphisms in this gene are associated with inflammatory bowel disease and multiple sclerosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous KO reduces dendrite branching and spine density as a result of reduced microtubule growth, resulting in impaired spatial learning and cued conditioning behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik T C 7: 40,993,858 I317T possibly damaging Het
4931406P16Rik G T 7: 34,245,708 N582K possibly damaging Het
4931409K22Rik C T 5: 24,552,650 E150K probably benign Het
Acsl5 G A 19: 55,268,828 probably null Het
Ahrr G A 13: 74,229,916 T136I probably damaging Het
AI597479 G A 1: 43,111,101 D124N probably damaging Het
Arap2 G T 5: 62,604,571 A1604D probably damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Cadps2 T C 6: 23,688,956 N118S probably benign Het
Caskin1 T A 17: 24,500,683 probably null Het
Cc2d1a C T 8: 84,135,760 V684M possibly damaging Het
Ccdc91 T C 6: 147,534,178 S87P possibly damaging Het
Cdr2l A G 11: 115,390,966 Q99R probably benign Het
Celsr3 T C 9: 108,838,004 L2066P possibly damaging Het
Cep95 A C 11: 106,809,224 L313F possibly damaging Het
Chst10 G A 1: 38,874,007 T63M probably damaging Het
Clrn2 G A 5: 45,453,916 G36R probably damaging Het
Cnn2 T G 10: 79,994,515 Y273* probably null Het
Crtap T C 9: 114,378,096 T365A probably benign Het
D630045J12Rik T C 6: 38,195,029 T735A possibly damaging Het
Disp2 C T 2: 118,791,811 A1008V probably damaging Het
Dmrt3 A G 19: 25,610,953 D52G probably damaging Het
Dmrta1 T G 4: 89,688,463 L52R probably damaging Het
Dmrta2 A G 4: 109,981,988 T311A probably damaging Het
Dnm1 T A 2: 32,340,467 N112Y probably damaging Het
Dysf T C 6: 84,087,876 probably null Het
Ep400 A G 5: 110,685,363 F2034L unknown Het
F12 G A 13: 55,418,497 A494V probably damaging Het
Fbp2 A T 13: 62,841,861 F210L probably benign Het
Fbxo31 T A 8: 121,554,321 Q362L possibly damaging Het
Fkbp4 C T 6: 128,435,824 A95T probably benign Het
Frmd6 T G 12: 70,877,209 C80W probably damaging Het
Fsip2 A G 2: 82,982,741 I3135V probably benign Het
Gm597 A T 1: 28,776,767 M728K possibly damaging Het
Guca2b T A 4: 119,657,690 E34V probably damaging Het
Hdlbp G A 1: 93,413,915 T974I probably damaging Het
Hsdl2 T A 4: 59,617,653 M460K possibly damaging Het
Ift172 C T 5: 31,272,075 V581M probably damaging Het
Ift74 A G 4: 94,660,952 K313R possibly damaging Het
Ints4 T A 7: 97,535,286 probably null Het
Kit A T 5: 75,615,374 Y272F probably benign Het
Krt77 G A 15: 101,865,496 T241M probably benign Het
Lce1j T A 3: 92,789,184 S96C unknown Het
Marveld3 T A 8: 109,948,188 D332V probably damaging Het
Matr3 G T 18: 35,572,921 V300F probably damaging Het
Mical1 T A 10: 41,485,257 probably null Het
Mslnl T A 17: 25,743,210 V194E probably benign Het
Mug1 C A 6: 121,880,905 T1119K probably damaging Het
Mug1 C T 6: 121,884,343 P1308S probably damaging Het
Neb C A 2: 52,305,283 probably null Het
Neo1 T A 9: 58,902,923 T1082S probably damaging Het
Nkx6-2 C T 7: 139,582,129 probably null Het
Olfr1065 T A 2: 86,445,308 I225L probably damaging Het
Olfr981 T C 9: 40,023,230 I279T probably benign Het
Orc1 A T 4: 108,595,459 E177V probably benign Het
Parp1 G A 1: 180,599,064 V924I possibly damaging Het
Pax2 A T 19: 44,788,859 I165F probably benign Het
Pnma2 C T 14: 66,916,531 P135S probably benign Het
Ranbp17 A G 11: 33,297,420 I718T probably damaging Het
Rbm25 T A 12: 83,664,191 D359E unknown Het
Rgs3 T C 4: 62,617,126 L194P probably damaging Het
Serpinb6b A G 13: 32,971,615 I104V probably benign Het
Smg9 A G 7: 24,420,861 D420G probably benign Het
Smpd1 C T 7: 105,554,486 probably benign Het
Snx17 T A 5: 31,197,348 M318K probably damaging Het
Stard10 G A 7: 101,346,051 D337N probably damaging Het
Tex14 A G 11: 87,484,719 T103A probably damaging Het
Tle1 A G 4: 72,170,716 S97P probably benign Het
Tnfrsf8 T A 4: 145,315,084 M1L unknown Het
Traf3ip2 T C 10: 39,626,177 L107P possibly damaging Het
Trpc7 A T 13: 56,789,766 S626T possibly damaging Het
Ubl7 T A 9: 57,929,756 I350N probably damaging Het
Ubr3 T A 2: 70,021,623 I1878N probably damaging Het
Usp24 G T 4: 106,387,919 probably null Het
Vcan A T 13: 89,689,110 S2772T possibly damaging Het
Vmn2r79 T C 7: 87,037,643 V744A probably damaging Het
Wbp2nl T C 15: 82,305,702 S32P probably damaging Het
Wwc1 A G 11: 35,897,374 probably null Het
Zfp629 C T 7: 127,612,291 W115* probably null Het
Other mutations in Kif21b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Kif21b APN 1 136152342 missense possibly damaging 0.68
IGL01020:Kif21b APN 1 136154094 splice site probably benign
IGL01288:Kif21b APN 1 136172184 missense probably benign 0.00
IGL02105:Kif21b APN 1 136171303 missense probably benign
IGL02264:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02303:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02308:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02310:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02419:Kif21b APN 1 136151267 missense probably benign 0.00
IGL02553:Kif21b APN 1 136154121 missense probably damaging 1.00
IGL02568:Kif21b APN 1 136172867 missense probably damaging 0.96
IGL02657:Kif21b APN 1 136172230 missense possibly damaging 0.88
IGL03068:Kif21b APN 1 136158355 unclassified probably benign
IGL03230:Kif21b APN 1 136162812 missense probably benign 0.03
R0190:Kif21b UTSW 1 136171219 missense probably benign 0.32
R0349:Kif21b UTSW 1 136149311 missense probably damaging 0.97
R0501:Kif21b UTSW 1 136163099 missense probably benign 0.44
R0620:Kif21b UTSW 1 136159428 missense possibly damaging 0.88
R0629:Kif21b UTSW 1 136172157 critical splice acceptor site probably null
R0741:Kif21b UTSW 1 136159744 missense probably damaging 1.00
R1087:Kif21b UTSW 1 136162823 missense probably damaging 1.00
R1217:Kif21b UTSW 1 136152376 missense probably damaging 1.00
R1464:Kif21b UTSW 1 136156153 missense possibly damaging 0.50
R1464:Kif21b UTSW 1 136156153 missense possibly damaging 0.50
R1511:Kif21b UTSW 1 136169324 critical splice donor site probably null
R1512:Kif21b UTSW 1 136152805 missense probably benign 0.01
R1513:Kif21b UTSW 1 136156111 missense probably damaging 0.98
R1591:Kif21b UTSW 1 136149317 missense probably damaging 1.00
R1616:Kif21b UTSW 1 136171685 missense probably damaging 1.00
R1628:Kif21b UTSW 1 136171220 missense probably benign 0.01
R1658:Kif21b UTSW 1 136171285 missense probably damaging 1.00
R1728:Kif21b UTSW 1 136160121 missense possibly damaging 0.85
R1741:Kif21b UTSW 1 136156142 missense probably damaging 1.00
R1784:Kif21b UTSW 1 136160121 missense possibly damaging 0.85
R1807:Kif21b UTSW 1 136147793 missense possibly damaging 0.94
R1896:Kif21b UTSW 1 136147845 missense possibly damaging 0.90
R1970:Kif21b UTSW 1 136171156 missense probably damaging 1.00
R1984:Kif21b UTSW 1 136147546 missense probably damaging 1.00
R1985:Kif21b UTSW 1 136147546 missense probably damaging 1.00
R1986:Kif21b UTSW 1 136147546 missense probably damaging 1.00
R1988:Kif21b UTSW 1 136152264 missense probably damaging 0.98
R1990:Kif21b UTSW 1 136161770 missense probably damaging 1.00
R2014:Kif21b UTSW 1 136148282 missense probably damaging 1.00
R2045:Kif21b UTSW 1 136160313 missense probably damaging 1.00
R2141:Kif21b UTSW 1 136152264 missense probably damaging 0.98
R2248:Kif21b UTSW 1 136172966 missense probably damaging 1.00
R2886:Kif21b UTSW 1 136147874 splice site probably benign
R2896:Kif21b UTSW 1 136154217 missense possibly damaging 0.82
R3706:Kif21b UTSW 1 136159410 missense probably benign 0.06
R3780:Kif21b UTSW 1 136156226 missense probably damaging 0.99
R3827:Kif21b UTSW 1 136162994 critical splice donor site probably null
R4227:Kif21b UTSW 1 136154093 splice site probably null
R4600:Kif21b UTSW 1 136147864 missense probably benign 0.39
R4608:Kif21b UTSW 1 136148186 intron probably benign
R4749:Kif21b UTSW 1 136144749 nonsense probably null
R4841:Kif21b UTSW 1 136145220 missense probably damaging 1.00
R4842:Kif21b UTSW 1 136145220 missense probably damaging 1.00
R4933:Kif21b UTSW 1 136151325 splice site probably null
R4959:Kif21b UTSW 1 136148370 missense possibly damaging 0.90
R5018:Kif21b UTSW 1 136172234 missense probably benign 0.30
R5116:Kif21b UTSW 1 136152783 missense probably damaging 0.99
R5119:Kif21b UTSW 1 136163100 missense probably benign
R5197:Kif21b UTSW 1 136144625 missense probably damaging 1.00
R5230:Kif21b UTSW 1 136171673 missense probably damaging 1.00
R5249:Kif21b UTSW 1 136169228 missense probably damaging 1.00
R5337:Kif21b UTSW 1 136171143 missense probably damaging 1.00
R5358:Kif21b UTSW 1 136172292 missense possibly damaging 0.85
R5466:Kif21b UTSW 1 136147525 missense probably damaging 1.00
R5557:Kif21b UTSW 1 136170059 missense probably damaging 1.00
R5727:Kif21b UTSW 1 136170009 missense probably damaging 1.00
R5865:Kif21b UTSW 1 136151137 nonsense probably null
R5929:Kif21b UTSW 1 136151207 missense probably damaging 1.00
R6274:Kif21b UTSW 1 136149418 missense possibly damaging 0.57
R6349:Kif21b UTSW 1 136158326 missense probably damaging 1.00
R6648:Kif21b UTSW 1 136152397 missense probably benign 0.00
R6831:Kif21b UTSW 1 136144758 nonsense probably null
R7165:Kif21b UTSW 1 136149448 missense probably damaging 0.98
R7327:Kif21b UTSW 1 136159649 missense possibly damaging 0.60
R7680:Kif21b UTSW 1 136147869 critical splice donor site probably null
RF024:Kif21b UTSW 1 136158341 missense probably damaging 1.00
X0053:Kif21b UTSW 1 136149316 missense probably damaging 1.00
X0066:Kif21b UTSW 1 136172945 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCATCTTATACATGGGCATC -3'
(R):5'- GACACTGCTGGGACACACTAAC -3'

Sequencing Primer
(F):5'- CATGGGCATCTTTAAAGGCC -3'
(R):5'- TGCTGGGACACACTAACATTACTCTG -3'
Posted On2019-06-26