Mutagenetix > Incidental Mutations

Incidental Mutation 'R7156:Disp2'

557280

Institutional Source

Beutler Lab

Gene Symbol

Disp2

Ensembl Gene

ENSMUSG00000040035

Gene Name

dispatched RND tramsporter family member 2

Synonyms

B230210L08Rik, DispB

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.810) question?

Stock #

R7156 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

118779719-118811293 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 118791811 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 1008 (A1008V)

Ref Sequence

ENSEMBL: ENSMUSP00000037136 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037547] [ENSMUST00000063975] [ENSMUST00000110843] [ENSMUST00000110846]

Predicted Effect

probably damaging
Transcript: ENSMUST00000037547
AA Change: A1008V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000037136
Gene: ENSMUSG00000040035
AA Change: A1008V

Domain	Start	End	E-Value	Type
transmembrane domain	123	145	N/A	INTRINSIC
low complexity region	195	203	N/A	INTRINSIC
Pfam:MMPL	435	635	9.7e-8	PFAM
Pfam:Sterol-sensing	458	611	9.1e-9	PFAM
transmembrane domain	657	679	N/A	INTRINSIC
low complexity region	682	695	N/A	INTRINSIC
low complexity region	748	761	N/A	INTRINSIC
transmembrane domain	914	936	N/A	INTRINSIC
transmembrane domain	943	965	N/A	INTRINSIC
transmembrane domain	975	997	N/A	INTRINSIC
transmembrane domain	1018	1040	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000063975

SMART Domains

Protein: ENSMUSP00000070031
Gene: ENSMUSG00000040035

Domain	Start	End	E-Value	Type
transmembrane domain	123	145	N/A	INTRINSIC
low complexity region	195	203	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110843

SMART Domains

Protein: ENSMUSP00000106467
Gene: ENSMUSG00000040035

Domain	Start	End	E-Value	Type
transmembrane domain	123	145	N/A	INTRINSIC
low complexity region	195	203	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110846

SMART Domains

Protein: ENSMUSP00000106470
Gene: ENSMUSG00000040035

Domain	Start	End	E-Value	Type
transmembrane domain	123	145	N/A	INTRINSIC
low complexity region	195	203	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (81/81)

MGI Phenotype

FUNCTION: The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. [provided by RefSeq, Sep 2015]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	T	C	7: 40,993,858	I317T	possibly damaging	Het
4931406P16Rik	G	T	7: 34,245,708	N582K	possibly damaging	Het
4931409K22Rik	C	T	5: 24,552,650	E150K	probably benign	Het
Acsl5	G	A	19: 55,268,828		probably null	Het
Ahrr	G	A	13: 74,229,916	T136I	probably damaging	Het
AI597479	G	A	1: 43,111,101	D124N	probably damaging	Het
Arap2	G	T	5: 62,604,571	A1604D	probably damaging	Het
Bcl6	G	A	16: 23,966,226	R675*	probably null	Het
Cadps2	T	C	6: 23,688,956	N118S	probably benign	Het
Caskin1	T	A	17: 24,500,683		probably null	Het
Cc2d1a	C	T	8: 84,135,760	V684M	possibly damaging	Het
Ccdc91	T	C	6: 147,534,178	S87P	possibly damaging	Het
Cdr2l	A	G	11: 115,390,966	Q99R	probably benign	Het
Celsr3	T	C	9: 108,838,004	L2066P	possibly damaging	Het
Cep95	A	C	11: 106,809,224	L313F	possibly damaging	Het
Chst10	G	A	1: 38,874,007	T63M	probably damaging	Het
Clrn2	G	A	5: 45,453,916	G36R	probably damaging	Het
Cnn2	T	G	10: 79,994,515	Y273*	probably null	Het
Crtap	T	C	9: 114,378,096	T365A	probably benign	Het
D630045J12Rik	T	C	6: 38,195,029	T735A	possibly damaging	Het
Dmrt3	A	G	19: 25,610,953	D52G	probably damaging	Het
Dmrta1	T	G	4: 89,688,463	L52R	probably damaging	Het
Dmrta2	A	G	4: 109,981,988	T311A	probably damaging	Het
Dnm1	T	A	2: 32,340,467	N112Y	probably damaging	Het
Dysf	T	C	6: 84,087,876		probably null	Het
Ep400	A	G	5: 110,685,363	F2034L	unknown	Het
F12	G	A	13: 55,418,497	A494V	probably damaging	Het
Fbp2	A	T	13: 62,841,861	F210L	probably benign	Het
Fbxo31	T	A	8: 121,554,321	Q362L	possibly damaging	Het
Fkbp4	C	T	6: 128,435,824	A95T	probably benign	Het
Frmd6	T	G	12: 70,877,209	C80W	probably damaging	Het
Fsip2	A	G	2: 82,982,741	I3135V	probably benign	Het
Gm597	A	T	1: 28,776,767	M728K	possibly damaging	Het
Guca2b	T	A	4: 119,657,690	E34V	probably damaging	Het
Hdlbp	G	A	1: 93,413,915	T974I	probably damaging	Het
Hsdl2	T	A	4: 59,617,653	M460K	possibly damaging	Het
Ift172	C	T	5: 31,272,075	V581M	probably damaging	Het
Ift74	A	G	4: 94,660,952	K313R	possibly damaging	Het
Ints4	T	A	7: 97,535,286		probably null	Het
Kif21b	A	C	1: 136,147,824	T230P	probably damaging	Het
Kit	A	T	5: 75,615,374	Y272F	probably benign	Het
Krt77	G	A	15: 101,865,496	T241M	probably benign	Het
Lce1j	T	A	3: 92,789,184	S96C	unknown	Het
Marveld3	T	A	8: 109,948,188	D332V	probably damaging	Het
Matr3	G	T	18: 35,572,921	V300F	probably damaging	Het
Mical1	T	A	10: 41,485,257		probably null	Het
Mslnl	T	A	17: 25,743,210	V194E	probably benign	Het
Mug1	C	A	6: 121,880,905	T1119K	probably damaging	Het
Mug1	C	T	6: 121,884,343	P1308S	probably damaging	Het
Neb	C	A	2: 52,305,283		probably null	Het
Neo1	T	A	9: 58,902,923	T1082S	probably damaging	Het
Nkx6-2	C	T	7: 139,582,129		probably null	Het
Olfr1065	T	A	2: 86,445,308	I225L	probably damaging	Het
Olfr981	T	C	9: 40,023,230	I279T	probably benign	Het
Orc1	A	T	4: 108,595,459	E177V	probably benign	Het
Parp1	G	A	1: 180,599,064	V924I	possibly damaging	Het
Pax2	A	T	19: 44,788,859	I165F	probably benign	Het
Pnma2	C	T	14: 66,916,531	P135S	probably benign	Het
Ranbp17	A	G	11: 33,297,420	I718T	probably damaging	Het
Rbm25	T	A	12: 83,664,191	D359E	unknown	Het
Rgs3	T	C	4: 62,617,126	L194P	probably damaging	Het
Serpinb6b	A	G	13: 32,971,615	I104V	probably benign	Het
Smg9	A	G	7: 24,420,861	D420G	probably benign	Het
Smpd1	C	T	7: 105,554,486		probably benign	Het
Snx17	T	A	5: 31,197,348	M318K	probably damaging	Het
Stard10	G	A	7: 101,346,051	D337N	probably damaging	Het
Tex14	A	G	11: 87,484,719	T103A	probably damaging	Het
Tle1	A	G	4: 72,170,716	S97P	probably benign	Het
Tnfrsf8	T	A	4: 145,315,084	M1L	unknown	Het
Traf3ip2	T	C	10: 39,626,177	L107P	possibly damaging	Het
Trpc7	A	T	13: 56,789,766	S626T	possibly damaging	Het
Ubl7	T	A	9: 57,929,756	I350N	probably damaging	Het
Ubr3	T	A	2: 70,021,623	I1878N	probably damaging	Het
Usp24	G	T	4: 106,387,919		probably null	Het
Vcan	A	T	13: 89,689,110	S2772T	possibly damaging	Het
Vmn2r79	T	C	7: 87,037,643	V744A	probably damaging	Het
Wbp2nl	T	C	15: 82,305,702	S32P	probably damaging	Het
Wwc1	A	G	11: 35,897,374		probably null	Het
Zfp629	C	T	7: 127,612,291	W115*	probably null	Het

Other mutations in Disp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Disp2	APN	2	118786278	missense	probably damaging	1.00
IGL00970:Disp2	APN	2	118791793	missense	probably damaging	1.00
IGL01790:Disp2	APN	2	118790880	missense	probably damaging	1.00
IGL01809:Disp2	APN	2	118787264	splice site	probably benign
IGL02069:Disp2	APN	2	118790680	missense	possibly damaging	0.93
IGL02140:Disp2	APN	2	118790869	missense	probably benign
IGL02143:Disp2	APN	2	118789969	missense	probably damaging	1.00
IGL02155:Disp2	APN	2	118791804	missense	probably damaging	1.00
IGL02884:Disp2	APN	2	118787551	splice site	probably benign
IGL03113:Disp2	APN	2	118790778	unclassified	probably null
IGL03194:Disp2	APN	2	118787629	missense	probably damaging	1.00
PIT4453001:Disp2	UTSW	2	118787644	missense	probably benign	0.01
R0109:Disp2	UTSW	2	118791816	missense	probably damaging	1.00
R0126:Disp2	UTSW	2	118790338	missense	probably damaging	1.00
R0603:Disp2	UTSW	2	118792006	missense	probably damaging	1.00
R0610:Disp2	UTSW	2	118792236	missense	probably benign	0.02
R0639:Disp2	UTSW	2	118790844	missense	possibly damaging	0.74
R0673:Disp2	UTSW	2	118790844	missense	possibly damaging	0.74
R0755:Disp2	UTSW	2	118789762	missense	probably benign	0.00
R0781:Disp2	UTSW	2	118790439	missense	probably damaging	1.00
R1110:Disp2	UTSW	2	118790439	missense	probably damaging	1.00
R1148:Disp2	UTSW	2	118806418	critical splice donor site	probably null
R1148:Disp2	UTSW	2	118806418	critical splice donor site	probably null
R1243:Disp2	UTSW	2	118791822	missense	probably damaging	1.00
R1587:Disp2	UTSW	2	118791583	missense	probably damaging	1.00
R1739:Disp2	UTSW	2	118791550	missense	probably damaging	1.00
R1771:Disp2	UTSW	2	118791297	nonsense	probably null
R1781:Disp2	UTSW	2	118792561	missense	probably damaging	0.96
R1918:Disp2	UTSW	2	118791927	missense	probably benign
R1956:Disp2	UTSW	2	118792223	missense	probably benign	0.02
R2167:Disp2	UTSW	2	118791685	missense	probably damaging	1.00
R2206:Disp2	UTSW	2	118792244	missense	probably benign	0.02
R4031:Disp2	UTSW	2	118791880	missense	probably benign	0.27
R4617:Disp2	UTSW	2	118790162	missense	probably benign
R4656:Disp2	UTSW	2	118790563	missense	probably damaging	1.00
R4684:Disp2	UTSW	2	118792756	missense	probably damaging	1.00
R4696:Disp2	UTSW	2	118791684	nonsense	probably null
R4697:Disp2	UTSW	2	118791684	nonsense	probably null
R4738:Disp2	UTSW	2	118790326	missense	probably damaging	0.97
R4834:Disp2	UTSW	2	118792504	missense	probably benign	0.09
R4914:Disp2	UTSW	2	118790454	missense	probably damaging	0.99
R4915:Disp2	UTSW	2	118790454	missense	probably damaging	0.99
R4918:Disp2	UTSW	2	118790454	missense	probably damaging	0.99
R5045:Disp2	UTSW	2	118792062	missense	probably benign	0.03
R5208:Disp2	UTSW	2	118791805	missense	probably damaging	1.00
R5303:Disp2	UTSW	2	118810848	unclassified	probably benign
R5350:Disp2	UTSW	2	118787575	missense	probably benign	0.23
R5355:Disp2	UTSW	2	118786911	missense	probably benign	0.00
R6011:Disp2	UTSW	2	118790820	missense	possibly damaging	0.65
R6031:Disp2	UTSW	2	118789794	missense	probably benign	0.01
R6031:Disp2	UTSW	2	118789794	missense	probably benign	0.01
R6139:Disp2	UTSW	2	118790662	missense	probably damaging	0.97
R6169:Disp2	UTSW	2	118791550	missense	probably damaging	1.00
R6187:Disp2	UTSW	2	118792143	missense	probably damaging	1.00
R6209:Disp2	UTSW	2	118786921	missense	probably damaging	1.00
R6250:Disp2	UTSW	2	118790766	missense	probably damaging	1.00
R6392:Disp2	UTSW	2	118790749	missense	probably damaging	1.00
R7138:Disp2	UTSW	2	118786880	missense	probably benign
R7230:Disp2	UTSW	2	118791805	missense	probably damaging	1.00
R7400:Disp2	UTSW	2	118791886	missense	probably damaging	1.00
R7460:Disp2	UTSW	2	118789780	missense	probably damaging	1.00
R7505:Disp2	UTSW	2	118791088	missense	probably damaging	1.00
R7542:Disp2	UTSW	2	118791118	missense	probably damaging	0.97
R7728:Disp2	UTSW	2	118791480	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- CAGTCTGTTCTCTGTGGCAG -3'
(R):5'- AGGATCTGGCCACAGTTCTTTTC -3'

Sequencing Primer
(F):5'- CTCTGTGGCAGCTGTGG -3'
(R):5'- GTTCTTTTCTGGCCCGAAGAAACAG -3'

Posted On

2019-06-26