Incidental Mutation 'R7156:Tle1'
ID557284
Institutional Source Beutler Lab
Gene Symbol Tle1
Ensembl Gene ENSMUSG00000008305
Gene Nametransducin-like enhancer of split 1
SynonymsC230057C06Rik, Estm14, Grg1, Tle4l
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.597) question?
Stock #R7156 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location72117142-72200919 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72170716 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 97 (S97P)
Ref Sequence ENSEMBL: ENSMUSP00000072481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030095] [ENSMUST00000072695] [ENSMUST00000074216] [ENSMUST00000102848] [ENSMUST00000107337] [ENSMUST00000137075]
Predicted Effect probably damaging
Transcript: ENSMUST00000030095
AA Change: S97P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030095
Gene: ENSMUSG00000008305
AA Change: S97P

DomainStartEndE-ValueType
Pfam:TLE_N 1 143 9.1e-77 PFAM
low complexity region 155 183 N/A INTRINSIC
low complexity region 240 255 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 292 314 N/A INTRINSIC
low complexity region 411 422 N/A INTRINSIC
WD40 484 521 4.18e-2 SMART
WD40 527 568 1.03e-1 SMART
WD40 573 612 9.38e-5 SMART
WD40 615 654 1.14e-8 SMART
WD40 657 695 3.07e1 SMART
WD40 697 736 8.96e-2 SMART
WD40 737 777 4.14e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072695
AA Change: S97P

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000072481
Gene: ENSMUSG00000008305
AA Change: S97P

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 2.6e-78 PFAM
low complexity region 145 173 N/A INTRINSIC
low complexity region 230 245 N/A INTRINSIC
low complexity region 255 266 N/A INTRINSIC
low complexity region 282 304 N/A INTRINSIC
low complexity region 401 412 N/A INTRINSIC
WD40 474 511 4.18e-2 SMART
WD40 517 558 1.03e-1 SMART
WD40 563 602 9.38e-5 SMART
WD40 605 644 1.14e-8 SMART
WD40 647 685 3.07e1 SMART
WD40 687 726 8.96e-2 SMART
WD40 727 767 4.14e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074216
AA Change: S97P

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000073839
Gene: ENSMUSG00000008305
AA Change: S97P

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 1.3e-78 PFAM
low complexity region 145 173 N/A INTRINSIC
low complexity region 230 245 N/A INTRINSIC
low complexity region 255 266 N/A INTRINSIC
low complexity region 282 304 N/A INTRINSIC
low complexity region 401 412 N/A INTRINSIC
WD40 474 511 4.18e-2 SMART
WD40 517 558 1.03e-1 SMART
WD40 563 602 9.38e-5 SMART
WD40 605 644 1.14e-8 SMART
WD40 647 685 3.07e1 SMART
WD40 687 726 8.96e-2 SMART
WD40 727 767 4.14e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102848
AA Change: S105P

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099912
Gene: ENSMUSG00000008305
AA Change: S105P

DomainStartEndE-ValueType
Pfam:TLE_N 1 144 1.3e-76 PFAM
low complexity region 153 181 N/A INTRINSIC
low complexity region 238 253 N/A INTRINSIC
low complexity region 263 274 N/A INTRINSIC
low complexity region 290 312 N/A INTRINSIC
low complexity region 408 419 N/A INTRINSIC
WD40 481 518 4.18e-2 SMART
WD40 524 565 1.03e-1 SMART
WD40 570 609 9.38e-5 SMART
WD40 612 651 1.14e-8 SMART
WD40 654 692 3.07e1 SMART
WD40 694 733 8.96e-2 SMART
WD40 734 774 4.14e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107337
AA Change: S97P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102960
Gene: ENSMUSG00000008305
AA Change: S97P

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 7.2e-80 PFAM
low complexity region 145 173 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137075
AA Change: S119P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118683
Gene: ENSMUSG00000008305
AA Change: S119P

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Pfam:TLE_N 22 158 4.2e-77 PFAM
low complexity region 167 195 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (81/81)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik T C 7: 40,993,858 I317T possibly damaging Het
4931406P16Rik G T 7: 34,245,708 N582K possibly damaging Het
4931409K22Rik C T 5: 24,552,650 E150K probably benign Het
Acsl5 G A 19: 55,268,828 probably null Het
Ahrr G A 13: 74,229,916 T136I probably damaging Het
AI597479 G A 1: 43,111,101 D124N probably damaging Het
Arap2 G T 5: 62,604,571 A1604D probably damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Cadps2 T C 6: 23,688,956 N118S probably benign Het
Caskin1 T A 17: 24,500,683 probably null Het
Cc2d1a C T 8: 84,135,760 V684M possibly damaging Het
Ccdc91 T C 6: 147,534,178 S87P possibly damaging Het
Cdr2l A G 11: 115,390,966 Q99R probably benign Het
Celsr3 T C 9: 108,838,004 L2066P possibly damaging Het
Cep95 A C 11: 106,809,224 L313F possibly damaging Het
Chst10 G A 1: 38,874,007 T63M probably damaging Het
Clrn2 G A 5: 45,453,916 G36R probably damaging Het
Cnn2 T G 10: 79,994,515 Y273* probably null Het
Crtap T C 9: 114,378,096 T365A probably benign Het
D630045J12Rik T C 6: 38,195,029 T735A possibly damaging Het
Disp2 C T 2: 118,791,811 A1008V probably damaging Het
Dmrt3 A G 19: 25,610,953 D52G probably damaging Het
Dmrta1 T G 4: 89,688,463 L52R probably damaging Het
Dmrta2 A G 4: 109,981,988 T311A probably damaging Het
Dnm1 T A 2: 32,340,467 N112Y probably damaging Het
Dysf T C 6: 84,087,876 probably null Het
Ep400 A G 5: 110,685,363 F2034L unknown Het
F12 G A 13: 55,418,497 A494V probably damaging Het
Fbp2 A T 13: 62,841,861 F210L probably benign Het
Fbxo31 T A 8: 121,554,321 Q362L possibly damaging Het
Fkbp4 C T 6: 128,435,824 A95T probably benign Het
Frmd6 T G 12: 70,877,209 C80W probably damaging Het
Fsip2 A G 2: 82,982,741 I3135V probably benign Het
Gm597 A T 1: 28,776,767 M728K possibly damaging Het
Guca2b T A 4: 119,657,690 E34V probably damaging Het
Hdlbp G A 1: 93,413,915 T974I probably damaging Het
Hsdl2 T A 4: 59,617,653 M460K possibly damaging Het
Ift172 C T 5: 31,272,075 V581M probably damaging Het
Ift74 A G 4: 94,660,952 K313R possibly damaging Het
Ints4 T A 7: 97,535,286 probably null Het
Kif21b A C 1: 136,147,824 T230P probably damaging Het
Kit A T 5: 75,615,374 Y272F probably benign Het
Krt77 G A 15: 101,865,496 T241M probably benign Het
Lce1j T A 3: 92,789,184 S96C unknown Het
Marveld3 T A 8: 109,948,188 D332V probably damaging Het
Matr3 G T 18: 35,572,921 V300F probably damaging Het
Mical1 T A 10: 41,485,257 probably null Het
Mslnl T A 17: 25,743,210 V194E probably benign Het
Mug1 C A 6: 121,880,905 T1119K probably damaging Het
Mug1 C T 6: 121,884,343 P1308S probably damaging Het
Neb C A 2: 52,305,283 probably null Het
Neo1 T A 9: 58,902,923 T1082S probably damaging Het
Nkx6-2 C T 7: 139,582,129 probably null Het
Olfr1065 T A 2: 86,445,308 I225L probably damaging Het
Olfr981 T C 9: 40,023,230 I279T probably benign Het
Orc1 A T 4: 108,595,459 E177V probably benign Het
Parp1 G A 1: 180,599,064 V924I possibly damaging Het
Pax2 A T 19: 44,788,859 I165F probably benign Het
Pnma2 C T 14: 66,916,531 P135S probably benign Het
Ranbp17 A G 11: 33,297,420 I718T probably damaging Het
Rbm25 T A 12: 83,664,191 D359E unknown Het
Rgs3 T C 4: 62,617,126 L194P probably damaging Het
Serpinb6b A G 13: 32,971,615 I104V probably benign Het
Smg9 A G 7: 24,420,861 D420G probably benign Het
Smpd1 C T 7: 105,554,486 probably benign Het
Snx17 T A 5: 31,197,348 M318K probably damaging Het
Stard10 G A 7: 101,346,051 D337N probably damaging Het
Tex14 A G 11: 87,484,719 T103A probably damaging Het
Tnfrsf8 T A 4: 145,315,084 M1L unknown Het
Traf3ip2 T C 10: 39,626,177 L107P possibly damaging Het
Trpc7 A T 13: 56,789,766 S626T possibly damaging Het
Ubl7 T A 9: 57,929,756 I350N probably damaging Het
Ubr3 T A 2: 70,021,623 I1878N probably damaging Het
Usp24 G T 4: 106,387,919 probably null Het
Vcan A T 13: 89,689,110 S2772T possibly damaging Het
Vmn2r79 T C 7: 87,037,643 V744A probably damaging Het
Wbp2nl T C 15: 82,305,702 S32P probably damaging Het
Wwc1 A G 11: 35,897,374 probably null Het
Zfp629 C T 7: 127,612,291 W115* probably null Het
Other mutations in Tle1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Tle1 APN 4 72169118 missense possibly damaging 0.94
IGL00972:Tle1 APN 4 72122400 missense probably damaging 1.00
IGL01548:Tle1 APN 4 72170718 missense probably damaging 1.00
IGL01737:Tle1 APN 4 72197821 splice site probably benign
IGL01798:Tle1 APN 4 72137148 missense probably damaging 1.00
IGL01943:Tle1 APN 4 72122402 missense probably damaging 1.00
PIT4515001:Tle1 UTSW 4 72199319 missense possibly damaging 0.47
R0140:Tle1 UTSW 4 72120185 missense probably damaging 1.00
R0544:Tle1 UTSW 4 72124990 missense probably damaging 1.00
R0603:Tle1 UTSW 4 72118347 missense probably damaging 1.00
R0729:Tle1 UTSW 4 72126442 splice site probably benign
R0786:Tle1 UTSW 4 72199361 missense probably damaging 1.00
R0939:Tle1 UTSW 4 72118534 missense probably damaging 1.00
R1297:Tle1 UTSW 4 72124838 missense probably damaging 1.00
R1465:Tle1 UTSW 4 72139831 missense probably damaging 1.00
R1465:Tle1 UTSW 4 72139831 missense probably damaging 1.00
R1512:Tle1 UTSW 4 72141258 missense probably damaging 1.00
R1967:Tle1 UTSW 4 72120226 missense probably damaging 1.00
R2218:Tle1 UTSW 4 72199319 missense possibly damaging 0.47
R3713:Tle1 UTSW 4 72126422 missense possibly damaging 0.70
R4367:Tle1 UTSW 4 72118163 utr 3 prime probably benign
R4379:Tle1 UTSW 4 72118163 utr 3 prime probably benign
R4380:Tle1 UTSW 4 72118163 utr 3 prime probably benign
R4655:Tle1 UTSW 4 72145344 missense possibly damaging 0.68
R4662:Tle1 UTSW 4 72137098 missense possibly damaging 0.92
R4731:Tle1 UTSW 4 72125019 missense possibly damaging 0.71
R4732:Tle1 UTSW 4 72125019 missense possibly damaging 0.71
R4733:Tle1 UTSW 4 72125019 missense possibly damaging 0.71
R4812:Tle1 UTSW 4 72145354 missense probably damaging 0.98
R5066:Tle1 UTSW 4 72158267 missense probably benign 0.24
R5288:Tle1 UTSW 4 72141844 missense probably damaging 1.00
R5386:Tle1 UTSW 4 72141844 missense probably damaging 1.00
R5405:Tle1 UTSW 4 72138971 intron probably benign
R5579:Tle1 UTSW 4 72139808 missense probably damaging 1.00
R5590:Tle1 UTSW 4 72124971 missense possibly damaging 0.91
R5762:Tle1 UTSW 4 72120135 splice site probably null
R6617:Tle1 UTSW 4 72141280 missense probably damaging 0.98
R6750:Tle1 UTSW 4 72122450 missense probably damaging 1.00
R7077:Tle1 UTSW 4 72158375 missense probably benign 0.25
R7153:Tle1 UTSW 4 72139061 missense probably benign 0.03
R7266:Tle1 UTSW 4 72139687 critical splice donor site probably null
R7316:Tle1 UTSW 4 72118292 missense probably benign 0.01
R7478:Tle1 UTSW 4 72137112 missense probably damaging 0.96
R7523:Tle1 UTSW 4 72145418 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGATACTGTCATCCCTCCAGC -3'
(R):5'- CTGGTATCTACAGTGTATTTCCAGG -3'

Sequencing Primer
(F):5'- AGCAGCCTGCCCTTGGATG -3'
(R):5'- ACAGTGTATTTCCAGGTAATTATTGG -3'
Posted On2019-06-26