Mutagenetix > Incidental Mutation

Incidental Mutation 'R7156:Usp24'

557287

Institutional Source

Beutler Lab

Gene Symbol

Usp24

Ensembl Gene

ENSMUSG00000028514

Gene Name

ubiquitin specific peptidase 24

Synonyms

2810030C21Rik, 2700066K03Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7156 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

106316213-106441322 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to T at 106387919 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000133095 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094933] [ENSMUST00000165709]

AlphaFold

B1AY13

Predicted Effect

probably null
Transcript: ENSMUST00000094933

SMART Domains

Protein: ENSMUSP00000092538
Gene: ENSMUSG00000028514

Domain	Start	End	E-Value	Type
Blast:UBA	5	43	2e-16	BLAST
low complexity region	57	96	N/A	INTRINSIC
SCOP:d1gw5a_	348	882	6e-7	SMART
low complexity region	1031	1059	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1365	1378	N/A	INTRINSIC
Pfam:UCH	1685	2036	3.7e-54	PFAM
Pfam:UCH_1	1686	1993	1.8e-27	PFAM
low complexity region	2066	2081	N/A	INTRINSIC
low complexity region	2256	2267	N/A	INTRINSIC
low complexity region	2576	2592	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000165709

SMART Domains

Protein: ENSMUSP00000133095
Gene: ENSMUSG00000028514

Domain	Start	End	E-Value	Type
Blast:UBA	5	43	2e-16	BLAST
low complexity region	57	96	N/A	INTRINSIC
SCOP:d1gw5a_	348	883	8e-7	SMART
low complexity region	1032	1060	N/A	INTRINSIC
low complexity region	1125	1151	N/A	INTRINSIC
low complexity region	1366	1379	N/A	INTRINSIC
Pfam:UCH	1686	2037	2e-49	PFAM
Pfam:UCH_1	1687	1994	4e-24	PFAM
low complexity region	2067	2082	N/A	INTRINSIC
low complexity region	2257	2268	N/A	INTRINSIC
low complexity region	2577	2593	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (81/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP24 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	T	C	7: 40,993,858	I317T	possibly damaging	Het
4931406P16Rik	G	T	7: 34,245,708	N582K	possibly damaging	Het
4931409K22Rik	C	T	5: 24,552,650	E150K	probably benign	Het
Acsl5	G	A	19: 55,268,828		probably null	Het
Ahrr	G	A	13: 74,229,916	T136I	probably damaging	Het
AI597479	G	A	1: 43,111,101	D124N	probably damaging	Het
Arap2	G	T	5: 62,604,571	A1604D	probably damaging	Het
Bcl6	G	A	16: 23,966,226	R675*	probably null	Het
Cadps2	T	C	6: 23,688,956	N118S	probably benign	Het
Caskin1	T	A	17: 24,500,683		probably null	Het
Cc2d1a	C	T	8: 84,135,760	V684M	possibly damaging	Het
Ccdc91	T	C	6: 147,534,178	S87P	possibly damaging	Het
Cdr2l	A	G	11: 115,390,966	Q99R	probably benign	Het
Celsr3	T	C	9: 108,838,004	L2066P	possibly damaging	Het
Cep95	A	C	11: 106,809,224	L313F	possibly damaging	Het
Chst10	G	A	1: 38,874,007	T63M	probably damaging	Het
Clrn2	G	A	5: 45,453,916	G36R	probably damaging	Het
Cnn2	T	G	10: 79,994,515	Y273*	probably null	Het
Crtap	T	C	9: 114,378,096	T365A	probably benign	Het
D630045J12Rik	T	C	6: 38,195,029	T735A	possibly damaging	Het
Disp2	C	T	2: 118,791,811	A1008V	probably damaging	Het
Dmrt3	A	G	19: 25,610,953	D52G	probably damaging	Het
Dmrta1	T	G	4: 89,688,463	L52R	probably damaging	Het
Dmrta2	A	G	4: 109,981,988	T311A	probably damaging	Het
Dnm1	T	A	2: 32,340,467	N112Y	probably damaging	Het
Dysf	T	C	6: 84,087,876		probably null	Het
Ep400	A	G	5: 110,685,363	F2034L	unknown	Het
F12	G	A	13: 55,418,497	A494V	probably damaging	Het
Fbp2	A	T	13: 62,841,861	F210L	probably benign	Het
Fbxo31	T	A	8: 121,554,321	Q362L	possibly damaging	Het
Fkbp4	C	T	6: 128,435,824	A95T	probably benign	Het
Frmd6	T	G	12: 70,877,209	C80W	probably damaging	Het
Fsip2	A	G	2: 82,982,741	I3135V	probably benign	Het
Gm597	A	T	1: 28,776,767	M728K	possibly damaging	Het
Guca2b	T	A	4: 119,657,690	E34V	probably damaging	Het
Hdlbp	G	A	1: 93,413,915	T974I	probably damaging	Het
Hsdl2	T	A	4: 59,617,653	M460K	possibly damaging	Het
Ift172	C	T	5: 31,272,075	V581M	probably damaging	Het
Ift74	A	G	4: 94,660,952	K313R	possibly damaging	Het
Ints4	T	A	7: 97,535,286		probably null	Het
Kif21b	A	C	1: 136,147,824	T230P	probably damaging	Het
Kit	A	T	5: 75,615,374	Y272F	probably benign	Het
Krt77	G	A	15: 101,865,496	T241M	probably benign	Het
Lce1j	T	A	3: 92,789,184	S96C	unknown	Het
Marveld3	T	A	8: 109,948,188	D332V	probably damaging	Het
Matr3	G	T	18: 35,572,921	V300F	probably damaging	Het
Mical1	T	A	10: 41,485,257		probably null	Het
Mslnl	T	A	17: 25,743,210	V194E	probably benign	Het
Mug1	C	A	6: 121,880,905	T1119K	probably damaging	Het
Mug1	C	T	6: 121,884,343	P1308S	probably damaging	Het
Neb	C	A	2: 52,305,283		probably null	Het
Neo1	T	A	9: 58,902,923	T1082S	probably damaging	Het
Nkx6-2	C	T	7: 139,582,129		probably null	Het
Olfr1065	T	A	2: 86,445,308	I225L	probably damaging	Het
Olfr981	T	C	9: 40,023,230	I279T	probably benign	Het
Orc1	A	T	4: 108,595,459	E177V	probably benign	Het
Parp1	G	A	1: 180,599,064	V924I	possibly damaging	Het
Pax2	A	T	19: 44,788,859	I165F	probably benign	Het
Pnma2	C	T	14: 66,916,531	P135S	probably benign	Het
Ranbp17	A	G	11: 33,297,420	I718T	probably damaging	Het
Rbm25	T	A	12: 83,664,191	D359E	unknown	Het
Rgs3	T	C	4: 62,617,126	L194P	probably damaging	Het
Serpinb6b	A	G	13: 32,971,615	I104V	probably benign	Het
Smg9	A	G	7: 24,420,861	D420G	probably benign	Het
Smpd1	C	T	7: 105,554,486		probably benign	Het
Snx17	T	A	5: 31,197,348	M318K	probably damaging	Het
Stard10	G	A	7: 101,346,051	D337N	probably damaging	Het
Tex14	A	G	11: 87,484,719	T103A	probably damaging	Het
Tle1	A	G	4: 72,170,716	S97P	probably benign	Het
Tnfrsf8	T	A	4: 145,315,084	M1L	unknown	Het
Traf3ip2	T	C	10: 39,626,177	L107P	possibly damaging	Het
Trpc7	A	T	13: 56,789,766	S626T	possibly damaging	Het
Ubl7	T	A	9: 57,929,756	I350N	probably damaging	Het
Ubr3	T	A	2: 70,021,623	I1878N	probably damaging	Het
Vcan	A	T	13: 89,689,110	S2772T	possibly damaging	Het
Vmn2r79	T	C	7: 87,037,643	V744A	probably damaging	Het
Wbp2nl	T	C	15: 82,305,702	S32P	probably damaging	Het
Wwc1	A	G	11: 35,897,374		probably null	Het
Zfp629	C	T	7: 127,612,291	W115*	probably null	Het

Other mutations in Usp24

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00329:Usp24	APN	4	106359091	missense	probably benign
IGL00340:Usp24	APN	4	106401139	missense	probably damaging	0.99
IGL00480:Usp24	APN	4	106368106	missense	probably damaging	0.99
IGL00548:Usp24	APN	4	106341298	missense	probably damaging	0.96
IGL00655:Usp24	APN	4	106390318	missense	probably damaging	0.99
IGL00674:Usp24	APN	4	106372679	splice site	probably benign
IGL00718:Usp24	APN	4	106409704	missense	probably benign	0.10
IGL00803:Usp24	APN	4	106385526	splice site	probably benign
IGL01161:Usp24	APN	4	106436844	missense	probably benign	0.02
IGL01344:Usp24	APN	4	106379385	missense	possibly damaging	0.73
IGL01374:Usp24	APN	4	106380099	missense	possibly damaging	0.86
IGL01485:Usp24	APN	4	106362232	missense	probably benign	0.01
IGL01736:Usp24	APN	4	106423461	missense	probably benign	0.00
IGL01737:Usp24	APN	4	106387734	missense	probably benign	0.03
IGL01862:Usp24	APN	4	106408898	splice site	probably benign
IGL01981:Usp24	APN	4	106375768	splice site	probably benign
IGL02090:Usp24	APN	4	106411426	missense	possibly damaging	0.55
IGL02275:Usp24	APN	4	106387493	missense	probably damaging	1.00
IGL02352:Usp24	APN	4	106403925	missense	probably damaging	1.00
IGL02359:Usp24	APN	4	106403925	missense	probably damaging	1.00
IGL02391:Usp24	APN	4	106407129	missense	possibly damaging	0.60
IGL02418:Usp24	APN	4	106436360	missense	probably benign	0.07
IGL02537:Usp24	APN	4	106392367	missense	probably damaging	1.00
IGL02638:Usp24	APN	4	106438770	splice site	probably benign
IGL02638:Usp24	APN	4	106438772	splice site	probably benign
IGL02830:Usp24	APN	4	106347387	missense	possibly damaging	0.79
IGL03125:Usp24	APN	4	106392402	missense	probably benign	0.09
IGL03280:Usp24	APN	4	106380430	missense	probably damaging	1.00
IGL03350:Usp24	APN	4	106371079	nonsense	probably null
BB010:Usp24	UTSW	4	106428489	missense	probably benign
BB020:Usp24	UTSW	4	106428489	missense	probably benign
IGL03098:Usp24	UTSW	4	106371033	missense	probably benign	0.11
R0035:Usp24	UTSW	4	106368027	missense	probably benign	0.18
R0044:Usp24	UTSW	4	106412084	splice site	probably benign
R0086:Usp24	UTSW	4	106392360	missense	probably damaging	0.98
R0125:Usp24	UTSW	4	106397299	missense	possibly damaging	0.76
R0197:Usp24	UTSW	4	106407133	missense	probably damaging	1.00
R0240:Usp24	UTSW	4	106414404	nonsense	probably null
R0240:Usp24	UTSW	4	106414404	nonsense	probably null
R0491:Usp24	UTSW	4	106402105	missense	probably benign	0.41
R0687:Usp24	UTSW	4	106420504	missense	probably damaging	1.00
R0973:Usp24	UTSW	4	106371079	nonsense	probably null
R0973:Usp24	UTSW	4	106413678	splice site	probably null
R0973:Usp24	UTSW	4	106371079	nonsense	probably null
R0974:Usp24	UTSW	4	106371079	nonsense	probably null
R0974:Usp24	UTSW	4	106413678	splice site	probably null
R1163:Usp24	UTSW	4	106420960	missense	probably benign
R1293:Usp24	UTSW	4	106423553	missense	probably benign	0.19
R1333:Usp24	UTSW	4	106342353	missense	possibly damaging	0.55
R1476:Usp24	UTSW	4	106361933	missense	probably damaging	1.00
R1699:Usp24	UTSW	4	106438827	missense	probably damaging	0.99
R1728:Usp24	UTSW	4	106360421	missense	possibly damaging	0.85
R1729:Usp24	UTSW	4	106360421	missense	possibly damaging	0.85
R1753:Usp24	UTSW	4	106377559	missense	probably benign	0.04
R1917:Usp24	UTSW	4	106410286	missense	probably damaging	1.00
R2045:Usp24	UTSW	4	106400980	missense	possibly damaging	0.54
R2424:Usp24	UTSW	4	106399113	critical splice donor site	probably null
R2436:Usp24	UTSW	4	106409645	nonsense	probably null
R2513:Usp24	UTSW	4	106379405	splice site	probably null
R3824:Usp24	UTSW	4	106379066	missense	probably benign
R3831:Usp24	UTSW	4	106362012	critical splice donor site	probably null
R3833:Usp24	UTSW	4	106362012	critical splice donor site	probably null
R3982:Usp24	UTSW	4	106387883	missense	probably benign	0.38
R4022:Usp24	UTSW	4	106379224	splice site	probably benign
R4067:Usp24	UTSW	4	106359089	missense	possibly damaging	0.68
R4175:Usp24	UTSW	4	106316773	missense	probably benign	0.00
R4766:Usp24	UTSW	4	106416048	missense	probably damaging	1.00
R4771:Usp24	UTSW	4	106362180	splice site	probably null
R4798:Usp24	UTSW	4	106360162	missense	possibly damaging	0.82
R4809:Usp24	UTSW	4	106413676	critical splice donor site	probably null
R4822:Usp24	UTSW	4	106416047	missense	probably damaging	0.98
R4906:Usp24	UTSW	4	106388637	missense	probably benign	0.20
R4934:Usp24	UTSW	4	106426546	missense	probably benign	0.29
R5074:Usp24	UTSW	4	106420447	missense	probably benign	0.12
R5151:Usp24	UTSW	4	106399112	critical splice donor site	probably null
R5220:Usp24	UTSW	4	106382303	missense	possibly damaging	0.69
R5279:Usp24	UTSW	4	106385424	missense	possibly damaging	0.94
R5280:Usp24	UTSW	4	106341214	missense	probably benign	0.18
R5285:Usp24	UTSW	4	106407033	missense	probably benign	0.00
R5292:Usp24	UTSW	4	106418263	missense	probably benign	0.06
R5294:Usp24	UTSW	4	106362357	missense	possibly damaging	0.53
R5394:Usp24	UTSW	4	106408013	missense	probably damaging	1.00
R5517:Usp24	UTSW	4	106375674	missense	probably benign	0.02
R5522:Usp24	UTSW	4	106372721	missense	probably damaging	1.00
R5546:Usp24	UTSW	4	106416047	missense	probably damaging	0.98
R5756:Usp24	UTSW	4	106362483	missense	probably damaging	1.00
R5910:Usp24	UTSW	4	106380468	missense	probably damaging	0.99
R5972:Usp24	UTSW	4	106368067	missense	probably damaging	0.98
R6285:Usp24	UTSW	4	106374100	splice site	probably null
R6370:Usp24	UTSW	4	106380521	missense	probably null	0.20
R6630:Usp24	UTSW	4	106387835	missense	possibly damaging	0.69
R6754:Usp24	UTSW	4	106360420	missense	probably damaging	1.00
R7027:Usp24	UTSW	4	106362244	missense	probably benign	0.21
R7088:Usp24	UTSW	4	106387546	missense	probably damaging	1.00
R7129:Usp24	UTSW	4	106362215	missense	probably damaging	1.00
R7131:Usp24	UTSW	4	106382303	missense	possibly damaging	0.69
R7174:Usp24	UTSW	4	106362681	splice site	probably null
R7236:Usp24	UTSW	4	106406305	splice site	probably null
R7403:Usp24	UTSW	4	106407035	missense	possibly damaging	0.79
R7424:Usp24	UTSW	4	106379107	missense	probably benign	0.00
R7475:Usp24	UTSW	4	106342353	missense	possibly damaging	0.55
R7505:Usp24	UTSW	4	106379079	missense	probably damaging	1.00
R7782:Usp24	UTSW	4	106316574	missense	probably damaging	1.00
R7900:Usp24	UTSW	4	106409400	missense	probably damaging	1.00
R7933:Usp24	UTSW	4	106428489	missense	probably benign
R7940:Usp24	UTSW	4	106430544	missense	probably damaging	0.98
R8271:Usp24	UTSW	4	106428514	missense	probably damaging	0.98
R8348:Usp24	UTSW	4	106368736	missense	possibly damaging	0.82
R8448:Usp24	UTSW	4	106368736	missense	possibly damaging	0.82
R8483:Usp24	UTSW	4	106373756	missense	probably damaging	1.00
R8546:Usp24	UTSW	4	106402129	missense	probably benign	0.01
R8798:Usp24	UTSW	4	106379239	missense	probably benign	0.00
R8822:Usp24	UTSW	4	106412213	missense	probably benign	0.17
R8992:Usp24	UTSW	4	106377565	missense	probably benign	0.36
R9002:Usp24	UTSW	4	106418215	missense	possibly damaging	0.72
R9037:Usp24	UTSW	4	106379054	missense	probably damaging	0.99
R9068:Usp24	UTSW	4	106375678	missense	probably benign	0.09
R9096:Usp24	UTSW	4	106397311	missense	probably benign	0.00
R9180:Usp24	UTSW	4	106359050	missense	possibly damaging	0.71
R9199:Usp24	UTSW	4	106387484	missense	probably damaging	1.00
R9201:Usp24	UTSW	4	106420530	missense	probably benign	0.36
R9251:Usp24	UTSW	4	106360518	missense	probably benign	0.19
R9423:Usp24	UTSW	4	106431670	missense	probably damaging	1.00
R9459:Usp24	UTSW	4	106342358	missense	probably damaging	1.00
R9472:Usp24	UTSW	4	106403931	missense	probably benign	0.00
R9483:Usp24	UTSW	4	106362182	missense	probably damaging	0.99
R9534:Usp24	UTSW	4	106407115	missense	probably damaging	0.97
R9653:Usp24	UTSW	4	106347367	missense	probably benign	0.03
R9712:Usp24	UTSW	4	106347367	missense	probably benign	0.03
X0024:Usp24	UTSW	4	106360446	missense	probably benign	0.09
X0028:Usp24	UTSW	4	106368055	missense	probably benign	0.01
X0066:Usp24	UTSW	4	106355731	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- GGACAGACAATGCCAACATCATTAG -3'
(R):5'- TACTGCTGAGACCACGGAAG -3'

Sequencing Primer
(F):5'- TTAGATGAAGACCTCACCAAAGATG -3'
(R):5'- CACGGAAGGCGGTGTTTC -3'

Posted On

2019-06-26