Incidental Mutation 'R7156:Usp24'
ID557287
Institutional Source Beutler Lab
Gene Symbol Usp24
Ensembl Gene ENSMUSG00000028514
Gene Nameubiquitin specific peptidase 24
Synonyms2810030C21Rik, 2700066K03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7156 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location106316213-106441322 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 106387919 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094933] [ENSMUST00000165709]
Predicted Effect probably null
Transcript: ENSMUST00000094933
SMART Domains Protein: ENSMUSP00000092538
Gene: ENSMUSG00000028514

DomainStartEndE-ValueType
Blast:UBA 5 43 2e-16 BLAST
low complexity region 57 96 N/A INTRINSIC
SCOP:d1gw5a_ 348 882 6e-7 SMART
low complexity region 1031 1059 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1365 1378 N/A INTRINSIC
Pfam:UCH 1685 2036 3.7e-54 PFAM
Pfam:UCH_1 1686 1993 1.8e-27 PFAM
low complexity region 2066 2081 N/A INTRINSIC
low complexity region 2256 2267 N/A INTRINSIC
low complexity region 2576 2592 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165709
SMART Domains Protein: ENSMUSP00000133095
Gene: ENSMUSG00000028514

DomainStartEndE-ValueType
Blast:UBA 5 43 2e-16 BLAST
low complexity region 57 96 N/A INTRINSIC
SCOP:d1gw5a_ 348 883 8e-7 SMART
low complexity region 1032 1060 N/A INTRINSIC
low complexity region 1125 1151 N/A INTRINSIC
low complexity region 1366 1379 N/A INTRINSIC
Pfam:UCH 1686 2037 2e-49 PFAM
Pfam:UCH_1 1687 1994 4e-24 PFAM
low complexity region 2067 2082 N/A INTRINSIC
low complexity region 2257 2268 N/A INTRINSIC
low complexity region 2577 2593 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP24 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik T C 7: 40,993,858 I317T possibly damaging Het
4931406P16Rik G T 7: 34,245,708 N582K possibly damaging Het
4931409K22Rik C T 5: 24,552,650 E150K probably benign Het
Acsl5 G A 19: 55,268,828 probably null Het
Ahrr G A 13: 74,229,916 T136I probably damaging Het
AI597479 G A 1: 43,111,101 D124N probably damaging Het
Arap2 G T 5: 62,604,571 A1604D probably damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Cadps2 T C 6: 23,688,956 N118S probably benign Het
Caskin1 T A 17: 24,500,683 probably null Het
Cc2d1a C T 8: 84,135,760 V684M possibly damaging Het
Ccdc91 T C 6: 147,534,178 S87P possibly damaging Het
Cdr2l A G 11: 115,390,966 Q99R probably benign Het
Celsr3 T C 9: 108,838,004 L2066P possibly damaging Het
Cep95 A C 11: 106,809,224 L313F possibly damaging Het
Chst10 G A 1: 38,874,007 T63M probably damaging Het
Clrn2 G A 5: 45,453,916 G36R probably damaging Het
Cnn2 T G 10: 79,994,515 Y273* probably null Het
Crtap T C 9: 114,378,096 T365A probably benign Het
D630045J12Rik T C 6: 38,195,029 T735A possibly damaging Het
Disp2 C T 2: 118,791,811 A1008V probably damaging Het
Dmrt3 A G 19: 25,610,953 D52G probably damaging Het
Dmrta1 T G 4: 89,688,463 L52R probably damaging Het
Dmrta2 A G 4: 109,981,988 T311A probably damaging Het
Dnm1 T A 2: 32,340,467 N112Y probably damaging Het
Dysf T C 6: 84,087,876 probably null Het
Ep400 A G 5: 110,685,363 F2034L unknown Het
F12 G A 13: 55,418,497 A494V probably damaging Het
Fbp2 A T 13: 62,841,861 F210L probably benign Het
Fbxo31 T A 8: 121,554,321 Q362L possibly damaging Het
Fkbp4 C T 6: 128,435,824 A95T probably benign Het
Frmd6 T G 12: 70,877,209 C80W probably damaging Het
Fsip2 A G 2: 82,982,741 I3135V probably benign Het
Gm597 A T 1: 28,776,767 M728K possibly damaging Het
Guca2b T A 4: 119,657,690 E34V probably damaging Het
Hdlbp G A 1: 93,413,915 T974I probably damaging Het
Hsdl2 T A 4: 59,617,653 M460K possibly damaging Het
Ift172 C T 5: 31,272,075 V581M probably damaging Het
Ift74 A G 4: 94,660,952 K313R possibly damaging Het
Ints4 T A 7: 97,535,286 probably null Het
Kif21b A C 1: 136,147,824 T230P probably damaging Het
Kit A T 5: 75,615,374 Y272F probably benign Het
Krt77 G A 15: 101,865,496 T241M probably benign Het
Lce1j T A 3: 92,789,184 S96C unknown Het
Marveld3 T A 8: 109,948,188 D332V probably damaging Het
Matr3 G T 18: 35,572,921 V300F probably damaging Het
Mical1 T A 10: 41,485,257 probably null Het
Mslnl T A 17: 25,743,210 V194E probably benign Het
Mug1 C A 6: 121,880,905 T1119K probably damaging Het
Mug1 C T 6: 121,884,343 P1308S probably damaging Het
Neb C A 2: 52,305,283 probably null Het
Neo1 T A 9: 58,902,923 T1082S probably damaging Het
Nkx6-2 C T 7: 139,582,129 probably null Het
Olfr1065 T A 2: 86,445,308 I225L probably damaging Het
Olfr981 T C 9: 40,023,230 I279T probably benign Het
Orc1 A T 4: 108,595,459 E177V probably benign Het
Parp1 G A 1: 180,599,064 V924I possibly damaging Het
Pax2 A T 19: 44,788,859 I165F probably benign Het
Pnma2 C T 14: 66,916,531 P135S probably benign Het
Ranbp17 A G 11: 33,297,420 I718T probably damaging Het
Rbm25 T A 12: 83,664,191 D359E unknown Het
Rgs3 T C 4: 62,617,126 L194P probably damaging Het
Serpinb6b A G 13: 32,971,615 I104V probably benign Het
Smg9 A G 7: 24,420,861 D420G probably benign Het
Smpd1 C T 7: 105,554,486 probably benign Het
Snx17 T A 5: 31,197,348 M318K probably damaging Het
Stard10 G A 7: 101,346,051 D337N probably damaging Het
Tex14 A G 11: 87,484,719 T103A probably damaging Het
Tle1 A G 4: 72,170,716 S97P probably benign Het
Tnfrsf8 T A 4: 145,315,084 M1L unknown Het
Traf3ip2 T C 10: 39,626,177 L107P possibly damaging Het
Trpc7 A T 13: 56,789,766 S626T possibly damaging Het
Ubl7 T A 9: 57,929,756 I350N probably damaging Het
Ubr3 T A 2: 70,021,623 I1878N probably damaging Het
Vcan A T 13: 89,689,110 S2772T possibly damaging Het
Vmn2r79 T C 7: 87,037,643 V744A probably damaging Het
Wbp2nl T C 15: 82,305,702 S32P probably damaging Het
Wwc1 A G 11: 35,897,374 probably null Het
Zfp629 C T 7: 127,612,291 W115* probably null Het
Other mutations in Usp24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Usp24 APN 4 106359091 missense probably benign
IGL00340:Usp24 APN 4 106401139 missense probably damaging 0.99
IGL00480:Usp24 APN 4 106368106 missense probably damaging 0.99
IGL00548:Usp24 APN 4 106341298 missense probably damaging 0.96
IGL00655:Usp24 APN 4 106390318 missense probably damaging 0.99
IGL00674:Usp24 APN 4 106372679 splice site probably benign
IGL00718:Usp24 APN 4 106409704 missense probably benign 0.10
IGL00803:Usp24 APN 4 106385526 splice site probably benign
IGL01161:Usp24 APN 4 106436844 missense probably benign 0.02
IGL01344:Usp24 APN 4 106379385 missense possibly damaging 0.73
IGL01374:Usp24 APN 4 106380099 missense possibly damaging 0.86
IGL01485:Usp24 APN 4 106362232 missense probably benign 0.01
IGL01736:Usp24 APN 4 106423461 missense probably benign 0.00
IGL01737:Usp24 APN 4 106387734 missense probably benign 0.03
IGL01862:Usp24 APN 4 106408898 splice site probably benign
IGL01981:Usp24 APN 4 106375768 splice site probably benign
IGL02090:Usp24 APN 4 106411426 missense possibly damaging 0.55
IGL02275:Usp24 APN 4 106387493 missense probably damaging 1.00
IGL02352:Usp24 APN 4 106403925 missense probably damaging 1.00
IGL02359:Usp24 APN 4 106403925 missense probably damaging 1.00
IGL02391:Usp24 APN 4 106407129 missense possibly damaging 0.60
IGL02418:Usp24 APN 4 106436360 missense probably benign 0.07
IGL02537:Usp24 APN 4 106392367 missense probably damaging 1.00
IGL02638:Usp24 APN 4 106438770 splice site probably benign
IGL02638:Usp24 APN 4 106438772 splice site probably benign
IGL02830:Usp24 APN 4 106347387 missense possibly damaging 0.79
IGL03125:Usp24 APN 4 106392402 missense probably benign 0.09
IGL03280:Usp24 APN 4 106380430 missense probably damaging 1.00
IGL03350:Usp24 APN 4 106371079 nonsense probably null
IGL03098:Usp24 UTSW 4 106371033 missense probably benign 0.11
R0035:Usp24 UTSW 4 106368027 missense probably benign 0.18
R0044:Usp24 UTSW 4 106412084 splice site probably benign
R0086:Usp24 UTSW 4 106392360 missense probably damaging 0.98
R0125:Usp24 UTSW 4 106397299 missense possibly damaging 0.76
R0197:Usp24 UTSW 4 106407133 missense probably damaging 1.00
R0240:Usp24 UTSW 4 106414404 nonsense probably null
R0240:Usp24 UTSW 4 106414404 nonsense probably null
R0491:Usp24 UTSW 4 106402105 missense probably benign 0.41
R0687:Usp24 UTSW 4 106420504 missense probably damaging 1.00
R0973:Usp24 UTSW 4 106371079 nonsense probably null
R0973:Usp24 UTSW 4 106413678 splice site probably null
R0973:Usp24 UTSW 4 106371079 nonsense probably null
R0974:Usp24 UTSW 4 106371079 nonsense probably null
R0974:Usp24 UTSW 4 106413678 splice site probably null
R1163:Usp24 UTSW 4 106420960 missense probably benign
R1293:Usp24 UTSW 4 106423553 missense probably benign 0.19
R1333:Usp24 UTSW 4 106342353 missense possibly damaging 0.55
R1476:Usp24 UTSW 4 106361933 missense probably damaging 1.00
R1699:Usp24 UTSW 4 106438827 missense probably damaging 0.99
R1728:Usp24 UTSW 4 106360421 missense possibly damaging 0.85
R1729:Usp24 UTSW 4 106360421 missense possibly damaging 0.85
R1753:Usp24 UTSW 4 106377559 missense probably benign 0.04
R1917:Usp24 UTSW 4 106410286 missense probably damaging 1.00
R2045:Usp24 UTSW 4 106400980 missense possibly damaging 0.54
R2424:Usp24 UTSW 4 106399113 critical splice donor site probably null
R2436:Usp24 UTSW 4 106409645 nonsense probably null
R2513:Usp24 UTSW 4 106379405 splice site probably null
R3824:Usp24 UTSW 4 106379066 missense probably benign
R3831:Usp24 UTSW 4 106362012 critical splice donor site probably null
R3833:Usp24 UTSW 4 106362012 critical splice donor site probably null
R3982:Usp24 UTSW 4 106387883 missense probably benign 0.38
R4022:Usp24 UTSW 4 106379224 splice site probably benign
R4067:Usp24 UTSW 4 106359089 missense possibly damaging 0.68
R4175:Usp24 UTSW 4 106316773 missense probably benign 0.00
R4766:Usp24 UTSW 4 106416048 missense probably damaging 1.00
R4771:Usp24 UTSW 4 106362180 synonymous probably null
R4798:Usp24 UTSW 4 106360162 missense possibly damaging 0.82
R4809:Usp24 UTSW 4 106413676 critical splice donor site probably null
R4822:Usp24 UTSW 4 106416047 missense probably damaging 0.98
R4906:Usp24 UTSW 4 106388637 missense probably benign 0.20
R4934:Usp24 UTSW 4 106426546 missense probably benign 0.29
R5074:Usp24 UTSW 4 106420447 missense probably benign 0.12
R5151:Usp24 UTSW 4 106399112 critical splice donor site probably null
R5220:Usp24 UTSW 4 106382303 missense possibly damaging 0.69
R5279:Usp24 UTSW 4 106385424 missense possibly damaging 0.94
R5280:Usp24 UTSW 4 106341214 missense probably benign 0.18
R5285:Usp24 UTSW 4 106407033 missense probably benign 0.00
R5292:Usp24 UTSW 4 106418263 missense probably benign 0.06
R5294:Usp24 UTSW 4 106362357 missense possibly damaging 0.53
R5394:Usp24 UTSW 4 106408013 missense probably damaging 1.00
R5517:Usp24 UTSW 4 106375674 missense probably benign 0.02
R5522:Usp24 UTSW 4 106372721 missense probably damaging 1.00
R5546:Usp24 UTSW 4 106416047 missense probably damaging 0.98
R5756:Usp24 UTSW 4 106362483 missense probably damaging 1.00
R5910:Usp24 UTSW 4 106380468 missense probably damaging 0.99
R5972:Usp24 UTSW 4 106368067 missense probably damaging 0.98
R6285:Usp24 UTSW 4 106374100 intron probably null
R6370:Usp24 UTSW 4 106380521 missense probably null 0.20
R6630:Usp24 UTSW 4 106387835 missense possibly damaging 0.69
R6754:Usp24 UTSW 4 106360420 missense probably damaging 1.00
R7027:Usp24 UTSW 4 106362244 missense probably benign 0.21
R7088:Usp24 UTSW 4 106387546 missense probably damaging 1.00
R7129:Usp24 UTSW 4 106362215 missense probably damaging 1.00
R7131:Usp24 UTSW 4 106382303 missense possibly damaging 0.69
R7174:Usp24 UTSW 4 106362681 splice site probably null
R7236:Usp24 UTSW 4 106406305 intron probably null
R7403:Usp24 UTSW 4 106407035 missense possibly damaging 0.79
R7424:Usp24 UTSW 4 106379107 missense probably benign 0.00
R7475:Usp24 UTSW 4 106342353 missense possibly damaging 0.55
R7505:Usp24 UTSW 4 106379079 missense probably damaging 1.00
R7782:Usp24 UTSW 4 106316574 missense probably damaging 1.00
X0024:Usp24 UTSW 4 106360446 missense probably benign 0.09
X0028:Usp24 UTSW 4 106368055 missense probably benign 0.01
X0066:Usp24 UTSW 4 106355731 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GGACAGACAATGCCAACATCATTAG -3'
(R):5'- TACTGCTGAGACCACGGAAG -3'

Sequencing Primer
(F):5'- TTAGATGAAGACCTCACCAAAGATG -3'
(R):5'- CACGGAAGGCGGTGTTTC -3'
Posted On2019-06-26