Incidental Mutation 'R0585:Cyp2c39'
ID55730
Institutional Source Beutler Lab
Gene Symbol Cyp2c39
Ensembl Gene ENSMUSG00000025003
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 39
Synonyms
MMRRC Submission 038775-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R0585 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location39510862-39568529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39536759 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 169 (I169F)
Ref Sequence ENSEMBL: ENSMUSP00000025968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025968]
Predicted Effect probably benign
Transcript: ENSMUST00000025968
AA Change: I169F

PolyPhen 2 Score 0.433 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025968
Gene: ENSMUSG00000025003
AA Change: I169F

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:p450 30 487 1.1e-163 PFAM
Meta Mutation Damage Score 0.1001 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.2%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,550,723 V267A probably benign Het
9530003J23Rik T A 10: 117,238,451 I44F possibly damaging Het
Brdt T G 5: 107,356,882 probably null Het
Ccdc162 C T 10: 41,586,379 C1474Y probably benign Het
Ces2e T C 8: 104,929,821 S228P probably damaging Het
Clca1 G T 3: 145,032,625 H41N probably benign Het
Cyp2c65 A G 19: 39,069,242 K107R probably benign Het
Cyp2c67 T A 19: 39,638,694 N231Y possibly damaging Het
Eps8l3 G C 3: 107,881,197 D33H probably damaging Het
Evi5 T C 5: 107,813,536 probably benign Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Gm3993 T A 12: 20,072,148 probably null Het
Gtf2ird1 A C 5: 134,376,942 L28R probably damaging Het
Hsf4 A G 8: 105,271,031 D75G probably damaging Het
Larp4b A G 13: 9,147,493 T249A probably damaging Het
Larp4b A G 13: 9,170,701 D578G probably benign Het
Matn3 A T 12: 8,961,103 probably benign Het
Myo10 T A 15: 25,736,455 Y428N probably damaging Het
Nf1 T A 11: 79,568,701 D661E probably damaging Het
Nktr A G 9: 121,754,280 probably benign Het
Npbwr1 G A 1: 5,916,458 T279I possibly damaging Het
Olfr665 A C 7: 104,881,499 H264P probably damaging Het
Osmr T C 15: 6,837,793 I341V probably benign Het
Pan2 T C 10: 128,310,515 probably null Het
Pknox2 G A 9: 36,909,760 probably benign Het
Pla2g2d A C 4: 138,779,393 D50A probably benign Het
Ptprk C T 10: 28,575,668 L1051F probably damaging Het
Rap1gds1 G A 3: 139,021,872 T59M probably benign Het
Rps5 T C 7: 12,925,405 V41A possibly damaging Het
Ryr1 G T 7: 29,036,076 D4092E probably damaging Het
Spic T C 10: 88,676,043 Y117C probably damaging Het
Thrap3 A T 4: 126,178,574 probably null Het
Tlr9 C T 9: 106,225,076 T522I probably benign Het
Tspan3 A T 9: 56,145,932 probably benign Het
Ttn T C 2: 76,873,159 probably benign Het
Zfp773 T A 7: 7,132,575 I341L probably benign Het
Zmat3 G A 3: 32,361,105 P19S probably damaging Het
Other mutations in Cyp2c39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00646:Cyp2c39 APN 19 39513491 splice site probably benign
IGL01806:Cyp2c39 APN 19 39536820 missense probably damaging 1.00
IGL02158:Cyp2c39 APN 19 39568130 missense probably benign
IGL02219:Cyp2c39 APN 19 39568199 utr 3 prime probably benign
IGL02483:Cyp2c39 APN 19 39536787 missense probably damaging 1.00
IGL02490:Cyp2c39 APN 19 39539002 missense probably damaging 1.00
IGL02597:Cyp2c39 APN 19 39560887 nonsense probably null
IGL03089:Cyp2c39 APN 19 39563851 missense probably benign 0.00
IGL03197:Cyp2c39 APN 19 39566917 missense probably damaging 1.00
IGL03392:Cyp2c39 APN 19 39513323 missense probably benign 0.40
R0086:Cyp2c39 UTSW 19 39510913 missense unknown
R0369:Cyp2c39 UTSW 19 39513635 missense probably damaging 1.00
R0586:Cyp2c39 UTSW 19 39513490 splice site probably benign
R0906:Cyp2c39 UTSW 19 39510871 start codon destroyed probably null
R1613:Cyp2c39 UTSW 19 39539011 missense probably damaging 0.99
R1711:Cyp2c39 UTSW 19 39566891 missense probably damaging 1.00
R1780:Cyp2c39 UTSW 19 39538851 splice site probably benign
R2208:Cyp2c39 UTSW 19 39560961 missense possibly damaging 0.56
R2327:Cyp2c39 UTSW 19 39538953 missense probably benign 0.07
R3431:Cyp2c39 UTSW 19 39536862 missense probably damaging 0.99
R4847:Cyp2c39 UTSW 19 39560896 missense probably damaging 1.00
R4866:Cyp2c39 UTSW 19 39513576 missense probably benign 0.43
R4900:Cyp2c39 UTSW 19 39513576 missense probably benign 0.43
R4974:Cyp2c39 UTSW 19 39563879 missense probably benign 0.25
R5159:Cyp2c39 UTSW 19 39560934 missense possibly damaging 0.96
R5470:Cyp2c39 UTSW 19 39513530 missense possibly damaging 0.54
R5860:Cyp2c39 UTSW 19 39536826 missense probably damaging 1.00
R6013:Cyp2c39 UTSW 19 39513525 missense probably benign 0.03
R6018:Cyp2c39 UTSW 19 39510992 missense probably damaging 1.00
R6230:Cyp2c39 UTSW 19 39536802 missense probably damaging 1.00
R6261:Cyp2c39 UTSW 19 39568019 missense probably damaging 1.00
R6345:Cyp2c39 UTSW 19 39513171 critical splice acceptor site probably null
R6345:Cyp2c39 UTSW 19 39513172 critical splice acceptor site probably null
R6822:Cyp2c39 UTSW 19 39536817 missense probably damaging 0.98
R6925:Cyp2c39 UTSW 19 39513195 missense probably damaging 1.00
R7578:Cyp2c39 UTSW 19 39510956 missense probably damaging 1.00
R7871:Cyp2c39 UTSW 19 39560961 missense possibly damaging 0.56
R7954:Cyp2c39 UTSW 19 39560961 missense possibly damaging 0.56
R8032:Cyp2c39 UTSW 19 39510982 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCATTGTGGATACAGAGCTTCCAGG -3'
(R):5'- TTGGCATAGCAGAGGGCTGATGAC -3'

Sequencing Primer
(F):5'- GCTCTGCTCTTATTTAACTAGTGATG -3'
(R):5'- AGGGCTGATGACCCCATTC -3'
Posted On2013-07-11