Incidental Mutation 'R7156:Celsr3'
ID557320
Institutional Source Beutler Lab
Gene Symbol Celsr3
Ensembl Gene ENSMUSG00000023473
Gene Namecadherin, EGF LAG seven-pass G-type receptor 3
SynonymsFmi1, flamingo
MMRRC Submission
Accession Numbers

Genbank: NM_080437; MGI: 1858236 

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7156 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location108826320-108852969 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108838004 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 2066 (L2066P)
Ref Sequence ENSEMBL: ENSMUSP00000150759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024238] [ENSMUST00000213524]
Predicted Effect probably damaging
Transcript: ENSMUST00000024238
AA Change: L2064P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024238
Gene: ENSMUSG00000023473
AA Change: L2064P

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 264 293 N/A INTRINSIC
CA 338 422 2.25e-27 SMART
CA 446 534 5.05e-30 SMART
CA 558 640 7.6e-25 SMART
CA 664 745 7.36e-32 SMART
CA 769 847 5.95e-18 SMART
CA 871 950 5.25e-28 SMART
CA 974 1056 2.67e-29 SMART
CA 1080 1158 1.18e-21 SMART
CA 1186 1262 3.2e-1 SMART
low complexity region 1328 1335 N/A INTRINSIC
low complexity region 1350 1360 N/A INTRINSIC
EGF 1369 1424 1.02e-2 SMART
EGF 1429 1464 3.23e0 SMART
EGF 1467 1503 8.78e-2 SMART
LamG 1524 1691 2.27e-35 SMART
EGF 1714 1747 4.22e-4 SMART
LamG 1774 1913 9.02e-21 SMART
EGF 1938 1971 2.43e-4 SMART
EGF 1973 2009 1.3e-4 SMART
EGF_Lam 2066 2111 5.08e-7 SMART
HormR 2114 2176 3.42e-21 SMART
Pfam:GAIN 2188 2441 1.1e-57 PFAM
GPS 2467 2520 7.92e-20 SMART
Pfam:7tm_2 2527 2758 1.5e-56 PFAM
low complexity region 2813 2829 N/A INTRINSIC
low complexity region 2882 2906 N/A INTRINSIC
low complexity region 3058 3072 N/A INTRINSIC
low complexity region 3149 3189 N/A INTRINSIC
low complexity region 3239 3261 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000213524
AA Change: L2066P

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the flamingo subfamily, which is included in the cadherin superfamily. The flamingo cadherins consist of nonclassic-type cadherins that do not interact with catenins. They are plasma membrane proteins containing seven epidermal growth factor-like repeats, nine cadherin domains and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic feature of their subfamily. The encoded protein may be involved in the regulation of contact-dependent neurite growth and may play a role in tumor formation. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, abnormal neurvous system development, and abnormal respiratory system development. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik T C 7: 40,993,858 I317T possibly damaging Het
4931406P16Rik G T 7: 34,245,708 N582K possibly damaging Het
4931409K22Rik C T 5: 24,552,650 E150K probably benign Het
Acsl5 G A 19: 55,268,828 probably null Het
Ahrr G A 13: 74,229,916 T136I probably damaging Het
AI597479 G A 1: 43,111,101 D124N probably damaging Het
Arap2 G T 5: 62,604,571 A1604D probably damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Cadps2 T C 6: 23,688,956 N118S probably benign Het
Caskin1 T A 17: 24,500,683 probably null Het
Cc2d1a C T 8: 84,135,760 V684M possibly damaging Het
Ccdc91 T C 6: 147,534,178 S87P possibly damaging Het
Cdr2l A G 11: 115,390,966 Q99R probably benign Het
Cep95 A C 11: 106,809,224 L313F possibly damaging Het
Chst10 G A 1: 38,874,007 T63M probably damaging Het
Clrn2 G A 5: 45,453,916 G36R probably damaging Het
Cnn2 T G 10: 79,994,515 Y273* probably null Het
Crtap T C 9: 114,378,096 T365A probably benign Het
D630045J12Rik T C 6: 38,195,029 T735A possibly damaging Het
Disp2 C T 2: 118,791,811 A1008V probably damaging Het
Dmrt3 A G 19: 25,610,953 D52G probably damaging Het
Dmrta1 T G 4: 89,688,463 L52R probably damaging Het
Dmrta2 A G 4: 109,981,988 T311A probably damaging Het
Dnm1 T A 2: 32,340,467 N112Y probably damaging Het
Dysf T C 6: 84,087,876 probably null Het
Ep400 A G 5: 110,685,363 F2034L unknown Het
F12 G A 13: 55,418,497 A494V probably damaging Het
Fbp2 A T 13: 62,841,861 F210L probably benign Het
Fbxo31 T A 8: 121,554,321 Q362L possibly damaging Het
Fkbp4 C T 6: 128,435,824 A95T probably benign Het
Frmd6 T G 12: 70,877,209 C80W probably damaging Het
Fsip2 A G 2: 82,982,741 I3135V probably benign Het
Gm597 A T 1: 28,776,767 M728K possibly damaging Het
Guca2b T A 4: 119,657,690 E34V probably damaging Het
Hdlbp G A 1: 93,413,915 T974I probably damaging Het
Hsdl2 T A 4: 59,617,653 M460K possibly damaging Het
Ift172 C T 5: 31,272,075 V581M probably damaging Het
Ift74 A G 4: 94,660,952 K313R possibly damaging Het
Ints4 T A 7: 97,535,286 probably null Het
Kif21b A C 1: 136,147,824 T230P probably damaging Het
Kit A T 5: 75,615,374 Y272F probably benign Het
Krt77 G A 15: 101,865,496 T241M probably benign Het
Lce1j T A 3: 92,789,184 S96C unknown Het
Marveld3 T A 8: 109,948,188 D332V probably damaging Het
Matr3 G T 18: 35,572,921 V300F probably damaging Het
Mical1 T A 10: 41,485,257 probably null Het
Mslnl T A 17: 25,743,210 V194E probably benign Het
Mug1 C A 6: 121,880,905 T1119K probably damaging Het
Mug1 C T 6: 121,884,343 P1308S probably damaging Het
Neb C A 2: 52,305,283 probably null Het
Neo1 T A 9: 58,902,923 T1082S probably damaging Het
Nkx6-2 C T 7: 139,582,129 probably null Het
Olfr1065 T A 2: 86,445,308 I225L probably damaging Het
Olfr981 T C 9: 40,023,230 I279T probably benign Het
Orc1 A T 4: 108,595,459 E177V probably benign Het
Parp1 G A 1: 180,599,064 V924I possibly damaging Het
Pax2 A T 19: 44,788,859 I165F probably benign Het
Pnma2 C T 14: 66,916,531 P135S probably benign Het
Ranbp17 A G 11: 33,297,420 I718T probably damaging Het
Rbm25 T A 12: 83,664,191 D359E unknown Het
Rgs3 T C 4: 62,617,126 L194P probably damaging Het
Serpinb6b A G 13: 32,971,615 I104V probably benign Het
Smg9 A G 7: 24,420,861 D420G probably benign Het
Smpd1 C T 7: 105,554,486 probably benign Het
Snx17 T A 5: 31,197,348 M318K probably damaging Het
Stard10 G A 7: 101,346,051 D337N probably damaging Het
Tex14 A G 11: 87,484,719 T103A probably damaging Het
Tle1 A G 4: 72,170,716 S97P probably benign Het
Tnfrsf8 T A 4: 145,315,084 M1L unknown Het
Traf3ip2 T C 10: 39,626,177 L107P possibly damaging Het
Trpc7 A T 13: 56,789,766 S626T possibly damaging Het
Ubl7 T A 9: 57,929,756 I350N probably damaging Het
Ubr3 T A 2: 70,021,623 I1878N probably damaging Het
Usp24 G T 4: 106,387,919 probably null Het
Vcan A T 13: 89,689,110 S2772T possibly damaging Het
Vmn2r79 T C 7: 87,037,643 V744A probably damaging Het
Wbp2nl T C 15: 82,305,702 S32P probably damaging Het
Wwc1 A G 11: 35,897,374 probably null Het
Zfp629 C T 7: 127,612,291 W115* probably null Het
Other mutations in Celsr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Celsr3 APN 9 108848925 missense probably damaging 1.00
IGL00536:Celsr3 APN 9 108829192 missense probably benign 0.33
IGL00552:Celsr3 APN 9 108841263 missense possibly damaging 0.88
IGL00801:Celsr3 APN 9 108842576 missense probably benign
IGL01420:Celsr3 APN 9 108841190 critical splice acceptor site probably null
IGL01541:Celsr3 APN 9 108831708 missense probably damaging 1.00
IGL01619:Celsr3 APN 9 108834557 missense probably damaging 1.00
IGL01619:Celsr3 APN 9 108837404 missense probably benign 0.00
IGL01631:Celsr3 APN 9 108837404 missense probably benign 0.00
IGL01777:Celsr3 APN 9 108835942 missense probably benign 0.08
IGL01938:Celsr3 APN 9 108828415 missense probably benign 0.34
IGL02135:Celsr3 APN 9 108827556 missense probably benign 0.11
IGL02231:Celsr3 APN 9 108842510 missense probably damaging 1.00
IGL02234:Celsr3 APN 9 108829960 missense probably benign
IGL02392:Celsr3 APN 9 108834721 splice site probably benign
IGL02416:Celsr3 APN 9 108832119 missense probably damaging 1.00
IGL02421:Celsr3 APN 9 108840463 missense probably damaging 1.00
IGL02455:Celsr3 APN 9 108842893 missense probably benign 0.15
IGL02798:Celsr3 APN 9 108843575 missense probably damaging 1.00
IGL02939:Celsr3 APN 9 108849453 missense probably damaging 1.00
IGL02947:Celsr3 APN 9 108845935 missense probably benign 0.12
IGL02986:Celsr3 APN 9 108841255 unclassified probably null
IGL03089:Celsr3 APN 9 108826607 missense probably benign 0.04
IGL03162:Celsr3 APN 9 108842558 missense probably damaging 1.00
IGL03267:Celsr3 APN 9 108836525 splice site probably benign
Diminishment UTSW 9 108842708 intron probably benign
little_d UTSW 9 108827692 missense probably damaging 0.98
nogal UTSW 9 108835838 missense probably benign
F6893:Celsr3 UTSW 9 108835067 missense probably benign 0.00
PIT4243001:Celsr3 UTSW 9 108832308 missense probably benign 0.13
PIT4810001:Celsr3 UTSW 9 108845733 missense probably damaging 1.00
R0110:Celsr3 UTSW 9 108827005 missense possibly damaging 0.62
R0243:Celsr3 UTSW 9 108843724 splice site probably benign
R0382:Celsr3 UTSW 9 108829218 missense probably damaging 1.00
R0482:Celsr3 UTSW 9 108829073 nonsense probably null
R0510:Celsr3 UTSW 9 108827005 missense possibly damaging 0.62
R0630:Celsr3 UTSW 9 108827692 missense probably damaging 0.98
R0656:Celsr3 UTSW 9 108834655 missense possibly damaging 0.89
R0764:Celsr3 UTSW 9 108827818 missense probably damaging 1.00
R0883:Celsr3 UTSW 9 108842633 missense probably damaging 1.00
R0924:Celsr3 UTSW 9 108846025 missense possibly damaging 0.78
R1015:Celsr3 UTSW 9 108833176 missense probably benign 0.17
R1321:Celsr3 UTSW 9 108835870 missense probably damaging 1.00
R1423:Celsr3 UTSW 9 108826905 missense probably benign 0.00
R1497:Celsr3 UTSW 9 108848865 missense probably benign 0.14
R1520:Celsr3 UTSW 9 108848658 missense probably damaging 1.00
R1534:Celsr3 UTSW 9 108848884 missense probably damaging 0.99
R1569:Celsr3 UTSW 9 108829068 missense probably damaging 1.00
R1657:Celsr3 UTSW 9 108842952 nonsense probably null
R1753:Celsr3 UTSW 9 108831857 missense probably damaging 0.99
R1764:Celsr3 UTSW 9 108828958 missense probably damaging 1.00
R1801:Celsr3 UTSW 9 108834626 missense possibly damaging 0.88
R1838:Celsr3 UTSW 9 108829906 missense probably benign
R1839:Celsr3 UTSW 9 108829906 missense probably benign
R1874:Celsr3 UTSW 9 108835838 missense probably benign
R1875:Celsr3 UTSW 9 108835838 missense probably benign
R1953:Celsr3 UTSW 9 108843182 missense probably benign 0.19
R1960:Celsr3 UTSW 9 108845817 missense probably benign
R2113:Celsr3 UTSW 9 108838470 missense probably damaging 1.00
R2290:Celsr3 UTSW 9 108843224 missense probably damaging 1.00
R2369:Celsr3 UTSW 9 108842552 missense probably benign
R2373:Celsr3 UTSW 9 108842552 missense probably benign
R2374:Celsr3 UTSW 9 108842552 missense probably benign
R2375:Celsr3 UTSW 9 108842552 missense probably benign
R2844:Celsr3 UTSW 9 108829308 missense probably damaging 1.00
R2968:Celsr3 UTSW 9 108832191 missense probably damaging 1.00
R3103:Celsr3 UTSW 9 108837139 missense probably benign 0.31
R3159:Celsr3 UTSW 9 108827710 missense possibly damaging 0.94
R3791:Celsr3 UTSW 9 108842552 missense probably benign
R4194:Celsr3 UTSW 9 108843302 critical splice donor site probably null
R4329:Celsr3 UTSW 9 108846049 missense probably benign 0.00
R4365:Celsr3 UTSW 9 108829847 missense possibly damaging 0.47
R4419:Celsr3 UTSW 9 108843244 missense possibly damaging 0.84
R4484:Celsr3 UTSW 9 108846063 critical splice donor site probably null
R4582:Celsr3 UTSW 9 108845723 missense probably damaging 1.00
R4681:Celsr3 UTSW 9 108827754 missense possibly damaging 0.58
R4729:Celsr3 UTSW 9 108847652 missense probably benign 0.05
R4881:Celsr3 UTSW 9 108843941 missense probably damaging 1.00
R4893:Celsr3 UTSW 9 108849421 missense probably damaging 1.00
R5183:Celsr3 UTSW 9 108837560 missense probably damaging 0.99
R5207:Celsr3 UTSW 9 108832759 missense probably benign 0.01
R5290:Celsr3 UTSW 9 108843158 missense probably benign 0.01
R5327:Celsr3 UTSW 9 108842708 intron probably benign
R5345:Celsr3 UTSW 9 108832124 missense probably damaging 1.00
R5358:Celsr3 UTSW 9 108832025 missense possibly damaging 0.96
R5396:Celsr3 UTSW 9 108828582 missense probably damaging 1.00
R5414:Celsr3 UTSW 9 108840042 missense possibly damaging 0.88
R5452:Celsr3 UTSW 9 108844034 missense possibly damaging 0.68
R5467:Celsr3 UTSW 9 108828637 missense probably damaging 1.00
R5479:Celsr3 UTSW 9 108844544 critical splice donor site probably null
R5629:Celsr3 UTSW 9 108849067 missense probably benign 0.41
R5637:Celsr3 UTSW 9 108837133 missense probably damaging 1.00
R5652:Celsr3 UTSW 9 108838472 missense probably benign 0.03
R5739:Celsr3 UTSW 9 108827158 missense probably benign
R5785:Celsr3 UTSW 9 108827797 missense probably damaging 1.00
R5877:Celsr3 UTSW 9 108845727 missense probably damaging 0.98
R5961:Celsr3 UTSW 9 108831794 missense probably damaging 1.00
R6046:Celsr3 UTSW 9 108837151 missense probably benign 0.01
R6176:Celsr3 UTSW 9 108828355 missense probably damaging 1.00
R6291:Celsr3 UTSW 9 108828842 missense probably damaging 1.00
R6468:Celsr3 UTSW 9 108835790 missense probably benign 0.08
R6481:Celsr3 UTSW 9 108837084 missense possibly damaging 0.92
R6547:Celsr3 UTSW 9 108829128 missense probably damaging 1.00
R6763:Celsr3 UTSW 9 108827350 missense probably damaging 1.00
R6870:Celsr3 UTSW 9 108829191 missense probably benign 0.02
R6977:Celsr3 UTSW 9 108827715 missense probably benign
R7061:Celsr3 UTSW 9 108847594 nonsense probably null
R7122:Celsr3 UTSW 9 108828567 missense possibly damaging 0.90
R7166:Celsr3 UTSW 9 108842951 missense probably damaging 1.00
R7176:Celsr3 UTSW 9 108845762 missense probably benign
R7213:Celsr3 UTSW 9 108849040 missense probably damaging 0.98
R7314:Celsr3 UTSW 9 108829144 missense probably damaging 1.00
R7478:Celsr3 UTSW 9 108843578 missense probably benign 0.37
R7508:Celsr3 UTSW 9 108836622 missense probably benign
R7554:Celsr3 UTSW 9 108841209 missense probably benign
R7653:Celsr3 UTSW 9 108835070 nonsense probably null
X0018:Celsr3 UTSW 9 108827778 missense possibly damaging 0.65
X0018:Celsr3 UTSW 9 108840412 missense probably benign 0.01
X0026:Celsr3 UTSW 9 108828930 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAAACCCATCTGAGGCAAGTC -3'
(R):5'- GACTCTTCGCTAGAACCAATCC -3'

Sequencing Primer
(F):5'- ACCCATCTGAGGCAAGTCTTTTTAG -3'
(R):5'- GCTAGAACCAATCCTCTCCATGAG -3'
Posted On2019-06-26