Incidental Mutation 'R0586:Cfhr2'
ID55733
Institutional Source Beutler Lab
Gene Symbol Cfhr2
Ensembl Gene ENSMUSG00000033898
Gene Namecomplement factor H-related 2
Synonyms
MMRRC Submission 038776-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R0586 (G1)
Quality Score199
Status Validated
Chromosome1
Chromosomal Location139804167-139858702 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 139813434 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 268 (R268*)
Ref Sequence ENSEMBL: ENSMUSP00000142033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094489] [ENSMUST00000194186]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094489
AA Change: H268Y

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000092065
Gene: ENSMUSG00000033898
AA Change: H268Y

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CCP 28 81 2.7e-7 SMART
CCP 86 146 6.35e-4 SMART
CCP 150 203 7.57e-11 SMART
CCP 212 266 3.7e-14 SMART
CCP 270 331 1.16e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000194186
AA Change: R268*
SMART Domains Protein: ENSMUSP00000142033
Gene: ENSMUSG00000033898
AA Change: R268*

DomainStartEndE-ValueType
CCP 28 81 2.7e-7 SMART
CCP 86 146 6.35e-4 SMART
CCP 150 203 7.57e-11 SMART
CCP 212 266 3.7e-14 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.5%
  • 20x: 94.4%
Validation Efficiency 100% (74/74)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,137,091 V145D probably damaging Het
Abca1 A T 4: 53,092,860 V308E probably benign Het
Amy1 A G 3: 113,562,769 probably benign Het
Astn2 C T 4: 66,185,142 V345M unknown Het
Brwd1 T C 16: 96,043,086 E756G probably damaging Het
Ccpg1 C T 9: 73,001,821 L135F probably benign Het
Cecr2 C T 6: 120,757,884 H694Y probably damaging Het
Cfh G A 1: 140,183,182 T14I probably damaging Het
Clca1 T A 3: 145,032,589 I53L probably benign Het
Clcn6 A G 4: 148,038,749 probably benign Het
Cnfn C T 7: 25,367,831 V98I probably benign Het
Cntnap1 C T 11: 101,187,014 R1122W probably damaging Het
Cpne9 A T 6: 113,295,063 E384V probably damaging Het
Ctr9 T C 7: 111,049,498 probably benign Het
Ctsj T A 13: 61,003,701 probably benign Het
Cyp2c39 A C 19: 39,513,490 probably benign Het
Dock5 A C 14: 67,809,032 I767S probably damaging Het
Eftud2 T C 11: 102,846,620 T552A probably damaging Het
Epdr1 A G 13: 19,594,545 I25T probably damaging Het
Fam160a2 T C 7: 105,389,447 E195G probably damaging Het
Fam208b A G 13: 3,590,321 L272P probably damaging Het
Fcgbp A T 7: 28,089,713 D568V probably damaging Het
Frem2 T A 3: 53,647,921 T1732S probably damaging Het
Fuz T C 7: 44,898,558 V183A possibly damaging Het
Grb7 T C 11: 98,453,220 S284P probably damaging Het
Hoxb4 G T 11: 96,318,887 G40C probably damaging Het
Kcnn1 T C 8: 70,863,869 probably benign Het
Kmt2d C A 15: 98,835,207 probably benign Het
L3mbtl3 A G 10: 26,327,834 V366A unknown Het
Ldlr G A 9: 21,739,744 R486H probably benign Het
Lnpep A T 17: 17,575,396 probably benign Het
Mical3 A T 6: 121,029,641 probably benign Het
Myh15 T C 16: 49,171,887 probably benign Het
Nup155 T A 15: 8,130,232 H542Q probably benign Het
Olfr1100 T C 2: 86,978,782 N5D probably damaging Het
Olfr1240 T A 2: 89,439,354 R308S possibly damaging Het
Olfr53 T C 7: 140,652,063 F28S probably benign Het
Olfr780 A G 10: 129,322,047 I141M probably benign Het
Olfr967 A T 9: 39,751,118 H244L probably damaging Het
Opn4 A G 14: 34,598,973 probably benign Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Parp14 T C 16: 35,841,012 K1522R probably benign Het
Pkhd1 A T 1: 20,524,111 D1259E probably benign Het
Pogz C T 3: 94,879,353 A1084V probably damaging Het
Popdc3 G A 10: 45,315,263 V157M probably benign Het
Prrt4 T C 6: 29,171,184 Y423C probably damaging Het
Qrich1 C T 9: 108,534,520 H415Y probably damaging Het
Rabgap1 A G 2: 37,543,223 N801D probably benign Het
Rb1 A G 14: 73,287,684 probably benign Het
Rp1 A T 1: 4,347,837 N1017K possibly damaging Het
Ryr2 T C 13: 11,635,559 D356G probably null Het
Skint8 C G 4: 111,936,929 P172R probably damaging Het
Slc12a8 T G 16: 33,658,230 M643R possibly damaging Het
Sult1c1 A T 17: 53,964,085 probably benign Het
Tcaf1 T A 6: 42,673,539 M869L probably damaging Het
Tecpr1 T C 5: 144,217,401 N78S probably damaging Het
Tectb A T 19: 55,181,924 Y69F probably damaging Het
Them4 A T 3: 94,329,794 N187I possibly damaging Het
Tm9sf3 A G 19: 41,256,143 probably null Het
Tnik G T 3: 28,577,361 probably benign Het
Tns2 G T 15: 102,109,585 probably benign Het
Tnxb A G 17: 34,672,144 D487G probably damaging Het
Trim33 T A 3: 103,310,344 C202S probably damaging Het
Trpm2 T A 10: 77,923,516 I1145F probably damaging Het
Trpv2 A G 11: 62,592,770 T478A probably benign Het
Ube2e3 T C 2: 78,919,990 Y187H probably benign Het
Ubxn11 A G 4: 134,109,652 R64G possibly damaging Het
Wwtr1 T C 3: 57,459,066 T407A probably damaging Het
Zfyve26 A T 12: 79,268,728 S1325T possibly damaging Het
Other mutations in Cfhr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Cfhr2 APN 1 139831232 missense probably benign 0.09
IGL01721:Cfhr2 APN 1 139813614 missense probably benign 0.00
IGL02160:Cfhr2 APN 1 139810926 missense probably benign
IGL02189:Cfhr2 APN 1 139821759 missense probably damaging 0.98
IGL02802:Cfhr2 APN 1 139811024 intron probably benign
PIT4677001:Cfhr2 UTSW 1 139805379 missense unknown
R0470:Cfhr2 UTSW 1 139821779 missense probably damaging 1.00
R1401:Cfhr2 UTSW 1 139811019 missense probably benign 0.00
R1728:Cfhr2 UTSW 1 139813442 missense probably benign 0.00
R1728:Cfhr2 UTSW 1 139813459 missense probably benign 0.02
R1729:Cfhr2 UTSW 1 139813442 missense probably benign 0.00
R1729:Cfhr2 UTSW 1 139813459 missense probably benign 0.02
R1730:Cfhr2 UTSW 1 139813442 missense probably benign 0.00
R1730:Cfhr2 UTSW 1 139813459 missense probably benign 0.02
R1739:Cfhr2 UTSW 1 139813442 missense probably benign 0.00
R1739:Cfhr2 UTSW 1 139813459 missense probably benign 0.02
R1762:Cfhr2 UTSW 1 139813442 missense probably benign 0.00
R1762:Cfhr2 UTSW 1 139813459 missense probably benign 0.02
R1779:Cfhr2 UTSW 1 139858645 utr 5 prime probably null
R1783:Cfhr2 UTSW 1 139813442 missense probably benign 0.00
R1783:Cfhr2 UTSW 1 139813459 missense probably benign 0.02
R1784:Cfhr2 UTSW 1 139813442 missense probably benign 0.00
R1784:Cfhr2 UTSW 1 139813459 missense probably benign 0.02
R1785:Cfhr2 UTSW 1 139813442 missense probably benign 0.00
R1785:Cfhr2 UTSW 1 139813459 missense probably benign 0.02
R2130:Cfhr2 UTSW 1 139831155 missense probably benign 0.41
R2131:Cfhr2 UTSW 1 139831155 missense probably benign 0.41
R2141:Cfhr2 UTSW 1 139831155 missense probably benign 0.41
R2142:Cfhr2 UTSW 1 139831155 missense probably benign 0.41
R4626:Cfhr2 UTSW 1 139813576 missense probably damaging 1.00
R4938:Cfhr2 UTSW 1 139813527 missense probably benign 0.02
R5225:Cfhr2 UTSW 1 139821782 missense possibly damaging 0.69
R5578:Cfhr2 UTSW 1 139831068 nonsense probably null
R6144:Cfhr2 UTSW 1 139805415 unclassified probably benign
R6312:Cfhr2 UTSW 1 139831079 missense possibly damaging 0.47
R6370:Cfhr2 UTSW 1 139822327 missense probably damaging 1.00
R6587:Cfhr2 UTSW 1 139810858 missense probably benign 0.01
R7028:Cfhr2 UTSW 1 139831063 critical splice donor site probably null
R7051:Cfhr2 UTSW 1 139810978 missense probably benign 0.00
R7162:Cfhr2 UTSW 1 139813526 missense probably benign 0.08
R7166:Cfhr2 UTSW 1 139831101 nonsense probably null
R7503:Cfhr2 UTSW 1 139831214 missense probably damaging 0.99
R7752:Cfhr2 UTSW 1 139813584 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGCTGGTTCCAAGTTTTGTGGACA -3'
(R):5'- ATGTGGGCCTCCTCCACCTATTGACA -3'

Sequencing Primer
(F):5'- GTTCCAAGTTTTGTGGACATTAATAC -3'
(R):5'- AATGGAGACATCACCTCCTTG -3'
Posted On2013-07-11