Incidental Mutation 'R7157:Tnn'
ID557349
Institutional Source Beutler Lab
Gene Symbol Tnn
Ensembl Gene ENSMUSG00000026725
Gene Nametenascin N
SynonymsTnw, tenascin-W
MMRRC Submission
Accession Numbers

Genbank: NM_177839.3; Ensembl: ENSMUST00000039178

Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R7157 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location160085029-160153580 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 160126377 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 603 (K603*)
Ref Sequence ENSEMBL: ENSMUSP00000039452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039178] [ENSMUST00000131919]
Predicted Effect probably null
Transcript: ENSMUST00000039178
AA Change: K603*
SMART Domains Protein: ENSMUSP00000039452
Gene: ENSMUSG00000026725
AA Change: K603*

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.34e-9 SMART
FN3 883 960 9.04e-9 SMART
FN3 971 1048 1.07e-10 SMART
FN3 1059 1136 7.57e-11 SMART
FN3 1147 1224 4.59e-10 SMART
FN3 1235 1312 1.95e-4 SMART
FBG 1327 1539 1.16e-114 SMART
Predicted Effect probably null
Transcript: ENSMUST00000131919
AA Change: K603*
SMART Domains Protein: ENSMUSP00000115685
Gene: ENSMUSG00000026725
AA Change: K603*

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.57e-11 SMART
FN3 883 960 4.59e-10 SMART
FN3 971 1048 1.95e-4 SMART
FBG 1063 1275 1.16e-114 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,626,976 G701D probably damaging Het
6030468B19Rik T A 11: 117,802,954 N82K probably damaging Het
Abca17 A T 17: 24,335,590 V130E possibly damaging Het
Alpk2 T A 18: 65,266,277 K2077* probably null Het
Aox2 T C 1: 58,283,492 F73S probably benign Het
Ap3b1 T A 13: 94,532,034 C965* probably null Het
Arhgef10 T A 8: 14,930,030 V90E probably damaging Het
Atp5s A T 12: 69,741,788 N154Y probably benign Het
Atr T A 9: 95,869,900 H523Q probably benign Het
Bicdl1 G T 5: 115,651,857 Q511K possibly damaging Het
Capn15 A T 17: 25,965,254 N150K probably damaging Het
Card6 A T 15: 5,100,109 W602R probably benign Het
Clnk A T 5: 38,769,891 S82T possibly damaging Het
Cmah T C 13: 24,436,629 I282T probably damaging Het
Cog8 A G 8: 107,052,499 I382T probably benign Het
Dhrs7c G T 11: 67,809,896 probably null Het
Dhrs9 T A 2: 69,393,158 D83E probably damaging Het
Dmgdh G A 13: 93,715,535 G624E probably damaging Het
Dnajc30 C A 5: 135,064,715 F155L probably damaging Het
Drc7 A C 8: 95,074,150 K600T probably damaging Het
Efhb A C 17: 53,400,900 I745S probably damaging Het
Fasn T A 11: 120,810,465 K1988* probably null Het
Gad2 T C 2: 22,635,023 L273P probably damaging Het
Gm45861 A T 8: 27,542,508 K887* probably null Het
Gm45861 A T 8: 27,542,509 K887I unknown Het
Gm9195 A G 14: 72,480,781 Y152H probably damaging Het
Grip1 G A 10: 119,945,156 D237N probably damaging Het
Hamp A C 7: 30,942,536 C65G possibly damaging Het
Hes3 A G 4: 152,288,124 probably benign Het
Hgh1 T C 15: 76,370,450 I342T probably damaging Het
Hlcs T A 16: 94,268,164 K66* probably null Het
Ift80 A T 3: 68,990,944 C19* probably null Het
Ikbkap ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 4: 56,781,176 probably benign Het
Kbtbd12 C T 6: 88,618,668 C60Y probably damaging Het
Kdm4c T A 4: 74,345,567 V696E probably benign Het
Lect2 A G 13: 56,542,990 I117T unknown Het
Lipn T A 19: 34,076,990 Y209* probably null Het
Lpin3 G A 2: 160,898,707 V391I probably benign Het
Mocs2 A T 13: 114,824,607 I47L probably benign Het
Mogs T A 6: 83,118,507 H768Q probably benign Het
Nbeal1 T A 1: 60,237,158 I686N probably damaging Het
Nbeal1 T A 1: 60,260,634 C1376* probably null Het
Ninl A G 2: 150,949,343 Y1087H possibly damaging Het
Olfr1076 T A 2: 86,509,025 C189S probably damaging Het
Olfr1338 A G 4: 118,754,418 V42A possibly damaging Het
Olfr518 A G 7: 108,881,268 F113L probably benign Het
Olfr623 A C 7: 103,660,581 L223R probably damaging Het
Olfr729 A G 14: 50,148,232 L214S probably damaging Het
Olfr750 A G 14: 51,071,159 V78A possibly damaging Het
Pkn1 A G 8: 83,671,734 F768S probably damaging Het
Plekha2 A G 8: 25,063,941 F82L probably damaging Het
Ppie T C 4: 123,135,107 E111G probably benign Het
Rps6ka5 T C 12: 100,581,420 Y277C probably damaging Het
Scgb2b12 A G 7: 32,326,677 V30A probably benign Het
Serac1 A T 17: 6,074,201 S16T probably benign Het
Sf3a3 T C 4: 124,722,900 Y192H probably damaging Het
Slc14a1 A G 18: 78,102,411 V436A probably benign Het
Smc3 T A 19: 53,641,898 M1112K probably damaging Het
Tnk2 G A 16: 32,681,168 G1017E probably damaging Het
Trpm6 T C 19: 18,838,098 S1183P possibly damaging Het
Ttn A T 2: 76,784,380 V16964E possibly damaging Het
Usp17le G A 7: 104,768,489 T482I probably benign Het
Vmn1r219 T A 13: 23,163,355 M238K probably damaging Het
Wfs1 C T 5: 36,967,172 G792S probably benign Het
Xpa A T 4: 46,185,612 L122Q probably damaging Het
Other mutations in Tnn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Tnn APN 1 160125451 missense possibly damaging 0.65
IGL00433:Tnn APN 1 160098206 splice site probably benign
IGL00858:Tnn APN 1 160088392 critical splice donor site probably null
IGL00939:Tnn APN 1 160147530 missense probably damaging 1.00
IGL01569:Tnn APN 1 160120554 missense possibly damaging 0.51
IGL01591:Tnn APN 1 160125574 missense probably damaging 1.00
IGL01628:Tnn APN 1 160147602 missense possibly damaging 0.89
IGL01811:Tnn APN 1 160107135 missense probably damaging 1.00
IGL01813:Tnn APN 1 160088438 missense probably damaging 1.00
IGL02340:Tnn APN 1 160145205 missense probably benign 0.00
IGL02488:Tnn APN 1 160140593 missense probably benign 0.21
IGL02535:Tnn APN 1 160122652 splice site probably null
IGL02563:Tnn APN 1 160114553 missense probably damaging 1.00
IGL02572:Tnn APN 1 160086107 missense probably damaging 1.00
IGL02740:Tnn APN 1 160140777 splice site probably benign
IGL02818:Tnn APN 1 160116278 missense possibly damaging 0.86
IGL03284:Tnn APN 1 160125452 missense probably benign 0.01
1mM(1):Tnn UTSW 1 160097341 missense probably damaging 1.00
PIT4305001:Tnn UTSW 1 160086077 missense possibly damaging 0.91
R0023:Tnn UTSW 1 160104928 missense probably benign 0.00
R0234:Tnn UTSW 1 160088466 missense probably damaging 1.00
R0234:Tnn UTSW 1 160088466 missense probably damaging 1.00
R0316:Tnn UTSW 1 160120567 missense possibly damaging 0.93
R0492:Tnn UTSW 1 160120757 missense probably damaging 0.99
R0547:Tnn UTSW 1 160116337 intron probably benign
R1067:Tnn UTSW 1 160125398 missense probably damaging 1.00
R1563:Tnn UTSW 1 160125415 missense probably damaging 1.00
R1565:Tnn UTSW 1 160097265 missense probably damaging 1.00
R1615:Tnn UTSW 1 160118408 missense possibly damaging 0.93
R1637:Tnn UTSW 1 160147600 missense probably damaging 1.00
R1707:Tnn UTSW 1 160145144 missense probably damaging 1.00
R1758:Tnn UTSW 1 160147584 missense possibly damaging 0.61
R1797:Tnn UTSW 1 160140688 missense probably damaging 1.00
R1847:Tnn UTSW 1 160116182 missense possibly damaging 0.51
R1925:Tnn UTSW 1 160097229 missense probably damaging 1.00
R2182:Tnn UTSW 1 160140600 synonymous probably null
R2196:Tnn UTSW 1 160097228 nonsense probably null
R2225:Tnn UTSW 1 160147465 missense probably damaging 1.00
R2227:Tnn UTSW 1 160147465 missense probably damaging 1.00
R2286:Tnn UTSW 1 160110509 missense possibly damaging 0.89
R2850:Tnn UTSW 1 160139287 missense probably benign 0.00
R3110:Tnn UTSW 1 160116286 missense possibly damaging 0.71
R3111:Tnn UTSW 1 160107055 missense probably damaging 0.98
R3112:Tnn UTSW 1 160116286 missense possibly damaging 0.71
R3729:Tnn UTSW 1 160146240 missense probably damaging 1.00
R4183:Tnn UTSW 1 160097355 missense probably damaging 1.00
R4439:Tnn UTSW 1 160116080 missense probably benign
R4441:Tnn UTSW 1 160116080 missense probably benign
R4588:Tnn UTSW 1 160145111 missense probably benign 0.25
R4646:Tnn UTSW 1 160146042 missense probably benign
R4647:Tnn UTSW 1 160146042 missense probably benign
R4648:Tnn UTSW 1 160146042 missense probably benign
R4701:Tnn UTSW 1 160147768 missense possibly damaging 0.72
R4703:Tnn UTSW 1 160116245 missense possibly damaging 0.84
R4737:Tnn UTSW 1 160146089 missense probably damaging 1.00
R4801:Tnn UTSW 1 160145033 missense possibly damaging 0.90
R4802:Tnn UTSW 1 160145033 missense possibly damaging 0.90
R4868:Tnn UTSW 1 160130873 missense possibly damaging 0.64
R4977:Tnn UTSW 1 160120618 missense probably damaging 1.00
R5011:Tnn UTSW 1 160126379 missense possibly damaging 0.89
R5026:Tnn UTSW 1 160146137 missense probably benign 0.00
R5027:Tnn UTSW 1 160145211 missense probably damaging 1.00
R5049:Tnn UTSW 1 160140738 missense probably benign 0.00
R5119:Tnn UTSW 1 160120552 missense probably damaging 0.98
R5128:Tnn UTSW 1 160122894 missense probably damaging 0.98
R5234:Tnn UTSW 1 160144999 missense possibly damaging 0.95
R5398:Tnn UTSW 1 160147522 missense probably benign 0.00
R5424:Tnn UTSW 1 160122702 missense possibly damaging 0.69
R5452:Tnn UTSW 1 160110261 missense probably benign 0.13
R5466:Tnn UTSW 1 160120536 missense possibly damaging 0.93
R6022:Tnn UTSW 1 160110358 missense probably benign 0.00
R6062:Tnn UTSW 1 160098278 missense probably damaging 1.00
R6086:Tnn UTSW 1 160086120 missense probably damaging 1.00
R6132:Tnn UTSW 1 160146071 missense probably damaging 0.96
R6324:Tnn UTSW 1 160145204 missense probably damaging 0.96
R6455:Tnn UTSW 1 160114719 missense probably damaging 1.00
R6563:Tnn UTSW 1 160088398 missense probably damaging 1.00
R6650:Tnn UTSW 1 160114583 missense probably damaging 1.00
R6806:Tnn UTSW 1 160120708 missense possibly damaging 0.95
R6810:Tnn UTSW 1 160104842 missense probably damaging 1.00
R7243:Tnn UTSW 1 160107117 missense probably benign 0.07
R7340:Tnn UTSW 1 160146022 missense probably damaging 0.98
R7472:Tnn UTSW 1 160110347 missense probably benign 0.12
R7502:Tnn UTSW 1 160110359 missense probably benign 0.00
R7527:Tnn UTSW 1 160118504 missense possibly damaging 0.51
R7608:Tnn UTSW 1 160088414 nonsense probably null
X0019:Tnn UTSW 1 160086146 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAAAAGCGTCACTCCTGTGC -3'
(R):5'- GTGACAGAGAACAGCCTCTC -3'

Sequencing Primer
(F):5'- ACTTAGATTGTGCCGCAAGC -3'
(R):5'- TCTCTGTCTCGTGGGACCCAG -3'
Posted On2019-06-26