Incidental Mutation 'R0586:Ube2e3'
ID55736
Institutional Source Beutler Lab
Gene Symbol Ube2e3
Ensembl Gene ENSMUSG00000027011
Gene Nameubiquitin-conjugating enzyme E2E 3
SynonymsubcM2, Ubce4
MMRRC Submission 038776-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.462) question?
Stock #R0586 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location78868124-78921293 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78919990 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 187 (Y187H)
Ref Sequence ENSEMBL: ENSMUSP00000113463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028398] [ENSMUST00000121433]
Predicted Effect probably benign
Transcript: ENSMUST00000028398
AA Change: Y187H

PolyPhen 2 Score 0.409 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028398
Gene: ENSMUSG00000027011
AA Change: Y187H

DomainStartEndE-ValueType
low complexity region 8 38 N/A INTRINSIC
UBCc 64 207 3.91e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121433
AA Change: Y187H

PolyPhen 2 Score 0.409 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113463
Gene: ENSMUSG00000027011
AA Change: Y187H

DomainStartEndE-ValueType
low complexity region 8 38 N/A INTRINSIC
UBCc 64 207 3.91e-71 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153266
Meta Mutation Damage Score 0.7698 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.5%
  • 20x: 94.4%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein shares 100% sequence identity with the mouse and rat counterparts, which indicates that this enzyme is highly conserved in eukaryotes. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,137,091 V145D probably damaging Het
Abca1 A T 4: 53,092,860 V308E probably benign Het
Amy1 A G 3: 113,562,769 probably benign Het
Astn2 C T 4: 66,185,142 V345M unknown Het
Brwd1 T C 16: 96,043,086 E756G probably damaging Het
Ccpg1 C T 9: 73,001,821 L135F probably benign Het
Cecr2 C T 6: 120,757,884 H694Y probably damaging Het
Cfh G A 1: 140,183,182 T14I probably damaging Het
Cfhr2 G A 1: 139,813,434 R268* probably null Het
Clca1 T A 3: 145,032,589 I53L probably benign Het
Clcn6 A G 4: 148,038,749 probably benign Het
Cnfn C T 7: 25,367,831 V98I probably benign Het
Cntnap1 C T 11: 101,187,014 R1122W probably damaging Het
Cpne9 A T 6: 113,295,063 E384V probably damaging Het
Ctr9 T C 7: 111,049,498 probably benign Het
Ctsj T A 13: 61,003,701 probably benign Het
Cyp2c39 A C 19: 39,513,490 probably benign Het
Dock5 A C 14: 67,809,032 I767S probably damaging Het
Eftud2 T C 11: 102,846,620 T552A probably damaging Het
Epdr1 A G 13: 19,594,545 I25T probably damaging Het
Fam160a2 T C 7: 105,389,447 E195G probably damaging Het
Fam208b A G 13: 3,590,321 L272P probably damaging Het
Fcgbp A T 7: 28,089,713 D568V probably damaging Het
Frem2 T A 3: 53,647,921 T1732S probably damaging Het
Fuz T C 7: 44,898,558 V183A possibly damaging Het
Grb7 T C 11: 98,453,220 S284P probably damaging Het
Hoxb4 G T 11: 96,318,887 G40C probably damaging Het
Kcnn1 T C 8: 70,863,869 probably benign Het
Kmt2d C A 15: 98,835,207 probably benign Het
L3mbtl3 A G 10: 26,327,834 V366A unknown Het
Ldlr G A 9: 21,739,744 R486H probably benign Het
Lnpep A T 17: 17,575,396 probably benign Het
Mical3 A T 6: 121,029,641 probably benign Het
Myh15 T C 16: 49,171,887 probably benign Het
Nup155 T A 15: 8,130,232 H542Q probably benign Het
Olfr1100 T C 2: 86,978,782 N5D probably damaging Het
Olfr1240 T A 2: 89,439,354 R308S possibly damaging Het
Olfr53 T C 7: 140,652,063 F28S probably benign Het
Olfr780 A G 10: 129,322,047 I141M probably benign Het
Olfr967 A T 9: 39,751,118 H244L probably damaging Het
Opn4 A G 14: 34,598,973 probably benign Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Parp14 T C 16: 35,841,012 K1522R probably benign Het
Pkhd1 A T 1: 20,524,111 D1259E probably benign Het
Pogz C T 3: 94,879,353 A1084V probably damaging Het
Popdc3 G A 10: 45,315,263 V157M probably benign Het
Prrt4 T C 6: 29,171,184 Y423C probably damaging Het
Qrich1 C T 9: 108,534,520 H415Y probably damaging Het
Rabgap1 A G 2: 37,543,223 N801D probably benign Het
Rb1 A G 14: 73,287,684 probably benign Het
Rp1 A T 1: 4,347,837 N1017K possibly damaging Het
Ryr2 T C 13: 11,635,559 D356G probably null Het
Skint8 C G 4: 111,936,929 P172R probably damaging Het
Slc12a8 T G 16: 33,658,230 M643R possibly damaging Het
Sult1c1 A T 17: 53,964,085 probably benign Het
Tcaf1 T A 6: 42,673,539 M869L probably damaging Het
Tecpr1 T C 5: 144,217,401 N78S probably damaging Het
Tectb A T 19: 55,181,924 Y69F probably damaging Het
Them4 A T 3: 94,329,794 N187I possibly damaging Het
Tm9sf3 A G 19: 41,256,143 probably null Het
Tnik G T 3: 28,577,361 probably benign Het
Tns2 G T 15: 102,109,585 probably benign Het
Tnxb A G 17: 34,672,144 D487G probably damaging Het
Trim33 T A 3: 103,310,344 C202S probably damaging Het
Trpm2 T A 10: 77,923,516 I1145F probably damaging Het
Trpv2 A G 11: 62,592,770 T478A probably benign Het
Ubxn11 A G 4: 134,109,652 R64G possibly damaging Het
Wwtr1 T C 3: 57,459,066 T407A probably damaging Het
Zfyve26 A T 12: 79,268,728 S1325T possibly damaging Het
Other mutations in Ube2e3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02619:Ube2e3 APN 2 78918721 missense probably damaging 1.00
R0069:Ube2e3 UTSW 2 78919949 splice site probably benign
R0069:Ube2e3 UTSW 2 78919949 splice site probably benign
R4609:Ube2e3 UTSW 2 78918712 missense probably damaging 1.00
R6918:Ube2e3 UTSW 2 78920039 missense probably damaging 1.00
R7136:Ube2e3 UTSW 2 78913741 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CTAGTGATGAGCCCCTGATAGGTTACA -3'
(R):5'- GGAGTCTCCCAGTCTCCAAAGGATAAA -3'

Sequencing Primer
(F):5'- TTATTCCTAAACGGTCAGCCCTAAAG -3'
(R):5'- CAGTCTCCAAAGGATAAAGACAAG -3'
Posted On2013-07-11