Incidental Mutation 'R7157:Sf3a3'
ID557362
Institutional Source Beutler Lab
Gene Symbol Sf3a3
Ensembl Gene ENSMUSG00000028902
Gene Namesplicing factor 3a, subunit 3
Synonyms4930512K19Rik, 60kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R7157 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location124714776-124732460 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124722900 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 192 (Y192H)
Ref Sequence ENSEMBL: ENSMUSP00000030734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030734]
Predicted Effect probably damaging
Transcript: ENSMUST00000030734
AA Change: Y192H

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030734
Gene: ENSMUSG00000028902
AA Change: Y192H

DomainStartEndE-ValueType
Pfam:SF3a60_bindingd 74 100 3e-19 PFAM
Pfam:SF3A3 129 207 7.9e-27 PFAM
Pfam:Telomere_Sde2_2 244 303 3.1e-31 PFAM
low complexity region 354 377 N/A INTRINSIC
ZnF_C2H2 406 431 9.3e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes subunit 3 of the splicing factor 3a protein complex. The splicing factor 3a heterotrimer includes subunits 1, 2 and 3 and is necessary for the in vitro conversion of 15S U2 snRNP into an active 17S particle that performs pre-mRNA splicing. Subunit 3 interacts with subunit 1 through its amino-terminus while the zinc finger domain of subunit 3 plays a role in its binding to the 15S U2 snRNP. This gene has a pseudogene on chromosome 20. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,626,976 G701D probably damaging Het
6030468B19Rik T A 11: 117,802,954 N82K probably damaging Het
Abca17 A T 17: 24,335,590 V130E possibly damaging Het
Alpk2 T A 18: 65,266,277 K2077* probably null Het
Aox2 T C 1: 58,283,492 F73S probably benign Het
Ap3b1 T A 13: 94,532,034 C965* probably null Het
Arhgef10 T A 8: 14,930,030 V90E probably damaging Het
Atp5s A T 12: 69,741,788 N154Y probably benign Het
Atr T A 9: 95,869,900 H523Q probably benign Het
Bicdl1 G T 5: 115,651,857 Q511K possibly damaging Het
Capn15 A T 17: 25,965,254 N150K probably damaging Het
Card6 A T 15: 5,100,109 W602R probably benign Het
Clnk A T 5: 38,769,891 S82T possibly damaging Het
Cmah T C 13: 24,436,629 I282T probably damaging Het
Cog8 A G 8: 107,052,499 I382T probably benign Het
Dhrs7c G T 11: 67,809,896 probably null Het
Dhrs9 T A 2: 69,393,158 D83E probably damaging Het
Dmgdh G A 13: 93,715,535 G624E probably damaging Het
Dnajc30 C A 5: 135,064,715 F155L probably damaging Het
Drc7 A C 8: 95,074,150 K600T probably damaging Het
Efhb A C 17: 53,400,900 I745S probably damaging Het
Fasn T A 11: 120,810,465 K1988* probably null Het
Gad2 T C 2: 22,635,023 L273P probably damaging Het
Gm45861 A T 8: 27,542,509 K887I unknown Het
Gm45861 A T 8: 27,542,508 K887* probably null Het
Gm9195 A G 14: 72,480,781 Y152H probably damaging Het
Grip1 G A 10: 119,945,156 D237N probably damaging Het
Hamp A C 7: 30,942,536 C65G possibly damaging Het
Hes3 A G 4: 152,288,124 probably benign Het
Hgh1 T C 15: 76,370,450 I342T probably damaging Het
Hlcs T A 16: 94,268,164 K66* probably null Het
Ift80 A T 3: 68,990,944 C19* probably null Het
Ikbkap ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 4: 56,781,176 probably benign Het
Kbtbd12 C T 6: 88,618,668 C60Y probably damaging Het
Kdm4c T A 4: 74,345,567 V696E probably benign Het
Lect2 A G 13: 56,542,990 I117T unknown Het
Lipn T A 19: 34,076,990 Y209* probably null Het
Lpin3 G A 2: 160,898,707 V391I probably benign Het
Mocs2 A T 13: 114,824,607 I47L probably benign Het
Mogs T A 6: 83,118,507 H768Q probably benign Het
Nbeal1 T A 1: 60,260,634 C1376* probably null Het
Nbeal1 T A 1: 60,237,158 I686N probably damaging Het
Ninl A G 2: 150,949,343 Y1087H possibly damaging Het
Olfr1076 T A 2: 86,509,025 C189S probably damaging Het
Olfr1338 A G 4: 118,754,418 V42A possibly damaging Het
Olfr518 A G 7: 108,881,268 F113L probably benign Het
Olfr623 A C 7: 103,660,581 L223R probably damaging Het
Olfr729 A G 14: 50,148,232 L214S probably damaging Het
Olfr750 A G 14: 51,071,159 V78A possibly damaging Het
Pkn1 A G 8: 83,671,734 F768S probably damaging Het
Plekha2 A G 8: 25,063,941 F82L probably damaging Het
Ppie T C 4: 123,135,107 E111G probably benign Het
Rps6ka5 T C 12: 100,581,420 Y277C probably damaging Het
Scgb2b12 A G 7: 32,326,677 V30A probably benign Het
Serac1 A T 17: 6,074,201 S16T probably benign Het
Slc14a1 A G 18: 78,102,411 V436A probably benign Het
Smc3 T A 19: 53,641,898 M1112K probably damaging Het
Tnk2 G A 16: 32,681,168 G1017E probably damaging Het
Tnn T A 1: 160,126,377 K603* probably null Het
Trpm6 T C 19: 18,838,098 S1183P possibly damaging Het
Ttn A T 2: 76,784,380 V16964E possibly damaging Het
Usp17le G A 7: 104,768,489 T482I probably benign Het
Vmn1r219 T A 13: 23,163,355 M238K probably damaging Het
Wfs1 C T 5: 36,967,172 G792S probably benign Het
Xpa A T 4: 46,185,612 L122Q probably damaging Het
Other mutations in Sf3a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Sf3a3 APN 4 124718343 missense possibly damaging 0.93
IGL01623:Sf3a3 APN 4 124718343 missense possibly damaging 0.93
PIT4495001:Sf3a3 UTSW 4 124728320 missense probably damaging 1.00
R0070:Sf3a3 UTSW 4 124714955 missense probably benign 0.04
R1441:Sf3a3 UTSW 4 124725142 missense probably damaging 0.99
R1858:Sf3a3 UTSW 4 124729495 missense probably damaging 1.00
R1928:Sf3a3 UTSW 4 124722093 missense possibly damaging 0.56
R1943:Sf3a3 UTSW 4 124715901 missense possibly damaging 0.95
R2101:Sf3a3 UTSW 4 124718343 missense possibly damaging 0.93
R2984:Sf3a3 UTSW 4 124718409 missense probably damaging 1.00
R3434:Sf3a3 UTSW 4 124725077 missense possibly damaging 0.95
R4366:Sf3a3 UTSW 4 124725139 missense probably benign
R4711:Sf3a3 UTSW 4 124728181 missense probably benign 0.01
R5032:Sf3a3 UTSW 4 124725166 missense probably benign 0.17
R5464:Sf3a3 UTSW 4 124728240 critical splice donor site probably null
R5607:Sf3a3 UTSW 4 124714953 missense probably damaging 1.00
R5997:Sf3a3 UTSW 4 124722058 missense probably damaging 0.99
R6166:Sf3a3 UTSW 4 124723384 intron probably benign
R7030:Sf3a3 UTSW 4 124722880 missense probably damaging 1.00
R7038:Sf3a3 UTSW 4 124728426 missense probably benign 0.16
R7184:Sf3a3 UTSW 4 124714979 missense probably benign 0.10
R7250:Sf3a3 UTSW 4 124722915 missense probably benign 0.03
Z1176:Sf3a3 UTSW 4 124714901 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCCTGCAAGTACAAATGAGC -3'
(R):5'- CGTCTTGAAGCAGAGACTCAAG -3'

Sequencing Primer
(F):5'- CTGCAAGTACAAATGAGCAGGCAC -3'
(R):5'- CCAGGAAAGGTGCCATTA -3'
Posted On2019-06-26