Incidental Mutation 'R7157:Wfs1'
ID557364
Institutional Source Beutler Lab
Gene Symbol Wfs1
Ensembl Gene ENSMUSG00000039474
Gene Namewolframin ER transmembrane glycoprotein
Synonymswolframin
MMRRC Submission
Accession Numbers

Genbank: NM_011716; MGI: 1328355

Is this an essential gene? Possibly non essential (E-score: 0.481) question?
Stock #R7157 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location36966104-36989205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 36967172 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 792 (G792S)
Ref Sequence ENSEMBL: ENSMUSP00000048053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043964] [ENSMUST00000166339]
Predicted Effect probably benign
Transcript: ENSMUST00000043964
AA Change: G792S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000048053
Gene: ENSMUSG00000039474
AA Change: G792S

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
low complexity region 50 67 N/A INTRINSIC
Blast:SEL1 101 139 1e-8 BLAST
low complexity region 268 275 N/A INTRINSIC
transmembrane domain 313 335 N/A INTRINSIC
transmembrane domain 342 364 N/A INTRINSIC
transmembrane domain 407 424 N/A INTRINSIC
transmembrane domain 431 453 N/A INTRINSIC
transmembrane domain 495 517 N/A INTRINSIC
transmembrane domain 529 551 N/A INTRINSIC
transmembrane domain 561 583 N/A INTRINSIC
transmembrane domain 590 612 N/A INTRINSIC
transmembrane domain 632 654 N/A INTRINSIC
low complexity region 877 886 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166339
AA Change: G716S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132404
Gene: ENSMUSG00000039474
AA Change: G716S

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
low complexity region 50 67 N/A INTRINSIC
Blast:SEL1 101 139 3e-8 BLAST
low complexity region 268 275 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
transmembrane domain 419 441 N/A INTRINSIC
transmembrane domain 453 475 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 514 536 N/A INTRINSIC
transmembrane domain 556 578 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167937
SMART Domains Protein: ENSMUSP00000125779
Gene: ENSMUSG00000039474

DomainStartEndE-ValueType
Blast:SEL1 20 58 4e-9 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein, which is located primarily in the endoplasmic reticulum and ubiquitously expressed with highest levels in brain, pancreas, heart, and insulinoma beta-cell lines. Mutations in this gene are associated with Wolfram syndrome, also called DIDMOAD (Diabetes Insipidus, Diabetes Mellitus, Optic Atrophy, and Deafness), an autosomal recessive disorder. The disease affects the brain and central nervous system. Mutations in this gene can also cause autosomal dominant deafness 6 (DFNA6), also known as DFNA14 or DFNA38. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased pancreatic beta cells and impaired glucose tolerance. Mice homozygous for a knock-out allele exhibit impaired glucose tolerance, decreased body weight, and abnormal behavior associated with increased sensitivity to stress. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(3) Gene trapped(1)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,626,976 G701D probably damaging Het
6030468B19Rik T A 11: 117,802,954 N82K probably damaging Het
Abca17 A T 17: 24,335,590 V130E possibly damaging Het
Alpk2 T A 18: 65,266,277 K2077* probably null Het
Aox2 T C 1: 58,283,492 F73S probably benign Het
Ap3b1 T A 13: 94,532,034 C965* probably null Het
Arhgef10 T A 8: 14,930,030 V90E probably damaging Het
Atp5s A T 12: 69,741,788 N154Y probably benign Het
Atr T A 9: 95,869,900 H523Q probably benign Het
Bicdl1 G T 5: 115,651,857 Q511K possibly damaging Het
Capn15 A T 17: 25,965,254 N150K probably damaging Het
Card6 A T 15: 5,100,109 W602R probably benign Het
Clnk A T 5: 38,769,891 S82T possibly damaging Het
Cmah T C 13: 24,436,629 I282T probably damaging Het
Cog8 A G 8: 107,052,499 I382T probably benign Het
Dhrs7c G T 11: 67,809,896 probably null Het
Dhrs9 T A 2: 69,393,158 D83E probably damaging Het
Dmgdh G A 13: 93,715,535 G624E probably damaging Het
Dnajc30 C A 5: 135,064,715 F155L probably damaging Het
Drc7 A C 8: 95,074,150 K600T probably damaging Het
Efhb A C 17: 53,400,900 I745S probably damaging Het
Fasn T A 11: 120,810,465 K1988* probably null Het
Gad2 T C 2: 22,635,023 L273P probably damaging Het
Gm45861 A T 8: 27,542,508 K887* probably null Het
Gm45861 A T 8: 27,542,509 K887I unknown Het
Gm9195 A G 14: 72,480,781 Y152H probably damaging Het
Grip1 G A 10: 119,945,156 D237N probably damaging Het
Hamp A C 7: 30,942,536 C65G possibly damaging Het
Hes3 A G 4: 152,288,124 probably benign Het
Hgh1 T C 15: 76,370,450 I342T probably damaging Het
Hlcs T A 16: 94,268,164 K66* probably null Het
Ift80 A T 3: 68,990,944 C19* probably null Het
Ikbkap ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 4: 56,781,176 probably benign Het
Kbtbd12 C T 6: 88,618,668 C60Y probably damaging Het
Kdm4c T A 4: 74,345,567 V696E probably benign Het
Lect2 A G 13: 56,542,990 I117T unknown Het
Lipn T A 19: 34,076,990 Y209* probably null Het
Lpin3 G A 2: 160,898,707 V391I probably benign Het
Mocs2 A T 13: 114,824,607 I47L probably benign Het
Mogs T A 6: 83,118,507 H768Q probably benign Het
Nbeal1 T A 1: 60,237,158 I686N probably damaging Het
Nbeal1 T A 1: 60,260,634 C1376* probably null Het
Ninl A G 2: 150,949,343 Y1087H possibly damaging Het
Olfr1076 T A 2: 86,509,025 C189S probably damaging Het
Olfr1338 A G 4: 118,754,418 V42A possibly damaging Het
Olfr518 A G 7: 108,881,268 F113L probably benign Het
Olfr623 A C 7: 103,660,581 L223R probably damaging Het
Olfr729 A G 14: 50,148,232 L214S probably damaging Het
Olfr750 A G 14: 51,071,159 V78A possibly damaging Het
Pkn1 A G 8: 83,671,734 F768S probably damaging Het
Plekha2 A G 8: 25,063,941 F82L probably damaging Het
Ppie T C 4: 123,135,107 E111G probably benign Het
Rps6ka5 T C 12: 100,581,420 Y277C probably damaging Het
Scgb2b12 A G 7: 32,326,677 V30A probably benign Het
Serac1 A T 17: 6,074,201 S16T probably benign Het
Sf3a3 T C 4: 124,722,900 Y192H probably damaging Het
Slc14a1 A G 18: 78,102,411 V436A probably benign Het
Smc3 T A 19: 53,641,898 M1112K probably damaging Het
Tnk2 G A 16: 32,681,168 G1017E probably damaging Het
Tnn T A 1: 160,126,377 K603* probably null Het
Trpm6 T C 19: 18,838,098 S1183P possibly damaging Het
Ttn A T 2: 76,784,380 V16964E possibly damaging Het
Usp17le G A 7: 104,768,489 T482I probably benign Het
Vmn1r219 T A 13: 23,163,355 M238K probably damaging Het
Xpa A T 4: 46,185,612 L122Q probably damaging Het
Other mutations in Wfs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Wfs1 APN 5 36967917 nonsense probably null
IGL01391:Wfs1 APN 5 36971563 missense probably benign 0.10
IGL01788:Wfs1 APN 5 36968636 missense probably benign 0.01
IGL02169:Wfs1 APN 5 36968479 missense probably damaging 0.99
IGL02814:Wfs1 APN 5 36967669 missense possibly damaging 0.88
IGL03294:Wfs1 APN 5 36975597 missense probably damaging 1.00
IGL03299:Wfs1 APN 5 36968387 nonsense probably null
2107:Wfs1 UTSW 5 36967273 missense probably damaging 1.00
R0077:Wfs1 UTSW 5 36973194 missense probably damaging 1.00
R0180:Wfs1 UTSW 5 36967028 missense probably damaging 0.96
R0402:Wfs1 UTSW 5 36976980 unclassified probably benign
R0458:Wfs1 UTSW 5 36968669 missense probably damaging 0.98
R0533:Wfs1 UTSW 5 36973722 splice site probably benign
R0890:Wfs1 UTSW 5 36975544 missense probably damaging 1.00
R0948:Wfs1 UTSW 5 36967561 missense probably damaging 1.00
R1413:Wfs1 UTSW 5 36982078 missense possibly damaging 0.65
R1759:Wfs1 UTSW 5 36967015 missense probably damaging 0.99
R2009:Wfs1 UTSW 5 36968309 missense probably damaging 0.96
R2137:Wfs1 UTSW 5 36967501 missense probably damaging 0.99
R2157:Wfs1 UTSW 5 36967942 missense probably damaging 1.00
R2216:Wfs1 UTSW 5 36967220 nonsense probably null
R3779:Wfs1 UTSW 5 36968624 missense probably benign 0.01
R3850:Wfs1 UTSW 5 36968624 missense probably benign 0.01
R3853:Wfs1 UTSW 5 36968624 missense probably benign 0.01
R3918:Wfs1 UTSW 5 36968624 missense probably benign 0.01
R4093:Wfs1 UTSW 5 36967465 missense probably damaging 0.97
R5056:Wfs1 UTSW 5 36975587 missense probably benign 0.00
R5849:Wfs1 UTSW 5 36973264 missense probably damaging 1.00
R5997:Wfs1 UTSW 5 36967750 missense probably damaging 0.99
R6666:Wfs1 UTSW 5 36967619 missense possibly damaging 0.94
R7024:Wfs1 UTSW 5 36966950 missense probably damaging 1.00
R7264:Wfs1 UTSW 5 36967846 missense probably damaging 1.00
R7269:Wfs1 UTSW 5 36967790 nonsense probably null
R7365:Wfs1 UTSW 5 36967732 missense probably benign 0.33
R7657:Wfs1 UTSW 5 36968234 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCATGCAGTTGAGGCAGCTG -3'
(R):5'- TGAGTCGGCCATCAACATGC -3'

Sequencing Primer
(F):5'- TGATGGCCTTGAGCTCGAAGAC -3'
(R):5'- GGCCATCAACATGCTCCCG -3'
Posted On2019-06-26