Incidental Mutation 'R7157:Dnajc30'
ID 557367
Institutional Source Beutler Lab
Gene Symbol Dnajc30
Ensembl Gene ENSMUSG00000061118
Gene Name DnaJ heat shock protein family (Hsp40) member C30
Synonyms 1300007M11Rik, Wbscr18
MMRRC Submission 045258-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7157 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 135093060-135094219 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 135093569 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 155 (F155L)
Ref Sequence ENSEMBL: ENSMUSP00000094318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071263] [ENSMUST00000071677] [ENSMUST00000085984] [ENSMUST00000111205] [ENSMUST00000141309] [ENSMUST00000148549] [ENSMUST00000201554]
AlphaFold P59041
Predicted Effect probably damaging
Transcript: ENSMUST00000071263
AA Change: F155L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000094318
Gene: ENSMUSG00000061118
AA Change: F155L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
DnaJ 41 99 8.75e-19 SMART
low complexity region 123 141 N/A INTRINSIC
low complexity region 167 187 N/A INTRINSIC
low complexity region 204 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071677
SMART Domains Protein: ENSMUSP00000071600
Gene: ENSMUSG00000005378

DomainStartEndE-ValueType
Pfam:Methyltransf_11 36 120 4.7e-13 PFAM
Pfam:WBS_methylT 182 258 9.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085984
SMART Domains Protein: ENSMUSP00000083146
Gene: ENSMUSG00000005378

DomainStartEndE-ValueType
Pfam:Methyltransf_11 58 143 5.3e-11 PFAM
Pfam:WBS_methylT 204 279 1.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111205
SMART Domains Protein: ENSMUSP00000106836
Gene: ENSMUSG00000005378

DomainStartEndE-ValueType
Pfam:Methyltransf_11 58 142 1.1e-12 PFAM
Pfam:WBS_methylT 168 245 1.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141309
Predicted Effect probably benign
Transcript: ENSMUST00000148549
SMART Domains Protein: ENSMUSP00000118370
Gene: ENSMUSG00000005378

DomainStartEndE-ValueType
Pfam:Methyltransf_23 3 89 1.4e-8 PFAM
Pfam:Methyltransf_11 27 93 5.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201554
Predicted Effect probably benign
Transcript: ENSMUST00000202478
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a member of the DNAJ molecular chaperone homology domain-containing protein family. This gene is deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,276,400 (GRCm39) G701D probably damaging Het
6030468B19Rik T A 11: 117,693,780 (GRCm39) N82K probably damaging Het
Abca17 A T 17: 24,554,564 (GRCm39) V130E possibly damaging Het
Alpk2 T A 18: 65,399,348 (GRCm39) K2077* probably null Het
Aox1 T C 1: 58,322,651 (GRCm39) F73S probably benign Het
Ap3b1 T A 13: 94,668,542 (GRCm39) C965* probably null Het
Arhgef10 T A 8: 14,980,030 (GRCm39) V90E probably damaging Het
Atr T A 9: 95,751,953 (GRCm39) H523Q probably benign Het
Bicdl1 G T 5: 115,789,916 (GRCm39) Q511K possibly damaging Het
Capn15 A T 17: 26,184,228 (GRCm39) N150K probably damaging Het
Card6 A T 15: 5,129,591 (GRCm39) W602R probably benign Het
Clnk A T 5: 38,927,234 (GRCm39) S82T possibly damaging Het
Cmah T C 13: 24,620,612 (GRCm39) I282T probably damaging Het
Cog8 A G 8: 107,779,131 (GRCm39) I382T probably benign Het
Dhrs7c G T 11: 67,700,722 (GRCm39) probably null Het
Dhrs9 T A 2: 69,223,502 (GRCm39) D83E probably damaging Het
Dmac2l A T 12: 69,788,562 (GRCm39) N154Y probably benign Het
Dmgdh G A 13: 93,852,043 (GRCm39) G624E probably damaging Het
Drc7 A C 8: 95,800,778 (GRCm39) K600T probably damaging Het
Efhb A C 17: 53,707,928 (GRCm39) I745S probably damaging Het
Elp1 ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 4: 56,781,176 (GRCm39) probably benign Het
Fasn T A 11: 120,701,291 (GRCm39) K1988* probably null Het
Gad2 T C 2: 22,525,035 (GRCm39) L273P probably damaging Het
Gm45861 A T 8: 28,032,536 (GRCm39) K887* probably null Het
Gm45861 A T 8: 28,032,537 (GRCm39) K887I unknown Het
Gm9195 A G 14: 72,718,221 (GRCm39) Y152H probably damaging Het
Grip1 G A 10: 119,781,061 (GRCm39) D237N probably damaging Het
Hamp A C 7: 30,641,961 (GRCm39) C65G possibly damaging Het
Hes3 A G 4: 152,372,581 (GRCm39) probably benign Het
Hgh1 T C 15: 76,254,650 (GRCm39) I342T probably damaging Het
Hlcs T A 16: 94,069,023 (GRCm39) K66* probably null Het
Ift80 A T 3: 68,898,277 (GRCm39) C19* probably null Het
Kbtbd12 C T 6: 88,595,650 (GRCm39) C60Y probably damaging Het
Kdm4c T A 4: 74,263,804 (GRCm39) V696E probably benign Het
Lect2 A G 13: 56,690,803 (GRCm39) I117T unknown Het
Lipn T A 19: 34,054,390 (GRCm39) Y209* probably null Het
Lpin3 G A 2: 160,740,627 (GRCm39) V391I probably benign Het
Mocs2 A T 13: 114,961,143 (GRCm39) I47L probably benign Het
Mogs T A 6: 83,095,488 (GRCm39) H768Q probably benign Het
Nbeal1 T A 1: 60,276,317 (GRCm39) I686N probably damaging Het
Nbeal1 T A 1: 60,299,793 (GRCm39) C1376* probably null Het
Ninl A G 2: 150,791,263 (GRCm39) Y1087H possibly damaging Het
Or10a3 A G 7: 108,480,475 (GRCm39) F113L probably benign Het
Or10ak14 A G 4: 118,611,615 (GRCm39) V42A possibly damaging Het
Or4k5 A G 14: 50,385,689 (GRCm39) L214S probably damaging Het
Or51b6b A C 7: 103,309,788 (GRCm39) L223R probably damaging Het
Or6s1 A G 14: 51,308,616 (GRCm39) V78A possibly damaging Het
Or8k30 T A 2: 86,339,369 (GRCm39) C189S probably damaging Het
Pkn1 A G 8: 84,398,363 (GRCm39) F768S probably damaging Het
Plekha2 A G 8: 25,553,957 (GRCm39) F82L probably damaging Het
Ppie T C 4: 123,028,900 (GRCm39) E111G probably benign Het
Rps6ka5 T C 12: 100,547,679 (GRCm39) Y277C probably damaging Het
Scgb2b12 A G 7: 32,026,102 (GRCm39) V30A probably benign Het
Serac1 A T 17: 6,124,476 (GRCm39) S16T probably benign Het
Sf3a3 T C 4: 124,616,693 (GRCm39) Y192H probably damaging Het
Slc14a1 A G 18: 78,145,626 (GRCm39) V436A probably benign Het
Smc3 T A 19: 53,630,329 (GRCm39) M1112K probably damaging Het
Tnk2 G A 16: 32,499,986 (GRCm39) G1017E probably damaging Het
Tnn T A 1: 159,953,947 (GRCm39) K603* probably null Het
Trpm6 T C 19: 18,815,462 (GRCm39) S1183P possibly damaging Het
Ttn A T 2: 76,614,724 (GRCm39) V16964E possibly damaging Het
Usp17le G A 7: 104,417,696 (GRCm39) T482I probably benign Het
Vmn1r219 T A 13: 23,347,525 (GRCm39) M238K probably damaging Het
Wfs1 C T 5: 37,124,516 (GRCm39) G792S probably benign Het
Xpa A T 4: 46,185,612 (GRCm39) L122Q probably damaging Het
Other mutations in Dnajc30
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1913:Dnajc30 UTSW 5 135,093,186 (GRCm39) missense probably benign 0.01
R2444:Dnajc30 UTSW 5 135,093,439 (GRCm39) missense probably damaging 1.00
R5940:Dnajc30 UTSW 5 135,093,413 (GRCm39) nonsense probably null
R7445:Dnajc30 UTSW 5 135,093,232 (GRCm39) missense probably damaging 1.00
R8029:Dnajc30 UTSW 5 135,093,186 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGAAGCTTACCTGGTCTTGG -3'
(R):5'- GCAGACCAATGGTTCAAAGGTC -3'

Sequencing Primer
(F):5'- TTACCTGGTCTTGGGCAGCAC -3'
(R):5'- TTCTCCGATTAAATACGAAAGCC -3'
Posted On 2019-06-26