Incidental Mutation 'R7157:Mogs'
ID557368
Institutional Source Beutler Lab
Gene Symbol Mogs
Ensembl Gene ENSMUSG00000030036
Gene Namemannosyl-oligosaccharide glucosidase
SynonymsGcs1, 1810017N02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7157 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location83115496-83118898 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83118507 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 768 (H768Q)
Ref Sequence ENSEMBL: ENSMUSP00000032114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032109] [ENSMUST00000032111] [ENSMUST00000032114] [ENSMUST00000113935] [ENSMUST00000113936] [ENSMUST00000143814] [ENSMUST00000146328] [ENSMUST00000151393] [ENSMUST00000205023]
Predicted Effect probably benign
Transcript: ENSMUST00000032109
SMART Domains Protein: ENSMUSP00000032109
Gene: ENSMUSG00000030034

DomainStartEndE-ValueType
low complexity region 23 39 N/A INTRINSIC
low complexity region 129 137 N/A INTRINSIC
low complexity region 161 177 N/A INTRINSIC
Pfam:PAPA-1 198 282 1.6e-27 PFAM
Pfam:zf-HIT 294 325 6.1e-10 PFAM
low complexity region 330 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000032111
SMART Domains Protein: ENSMUSP00000032111
Gene: ENSMUSG00000030035

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 31 N/A INTRINSIC
Pfam:WBP-1 71 177 1.4e-50 PFAM
low complexity region 185 200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000032114
AA Change: H768Q

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000032114
Gene: ENSMUSG00000030036
AA Change: H768Q

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
Pfam:Glyco_hydro_63N 91 267 1.1e-54 PFAM
Pfam:Glyco_hydro_63 349 832 7e-202 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113935
SMART Domains Protein: ENSMUSP00000109568
Gene: ENSMUSG00000030034

DomainStartEndE-ValueType
low complexity region 53 69 N/A INTRINSIC
low complexity region 159 167 N/A INTRINSIC
low complexity region 191 207 N/A INTRINSIC
Pfam:PAPA-1 228 309 4e-23 PFAM
Pfam:zf-HIT 324 355 4.3e-11 PFAM
low complexity region 360 373 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113936
SMART Domains Protein: ENSMUSP00000109569
Gene: ENSMUSG00000030035

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:WBP-1 36 142 1.2e-50 PFAM
low complexity region 150 165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131936
Predicted Effect probably benign
Transcript: ENSMUST00000143814
Predicted Effect probably benign
Transcript: ENSMUST00000146328
SMART Domains Protein: ENSMUSP00000122900
Gene: ENSMUSG00000030035

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 30 N/A INTRINSIC
Pfam:WBP-1 70 176 1.8e-50 PFAM
low complexity region 184 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151393
SMART Domains Protein: ENSMUSP00000145130
Gene: ENSMUSG00000030035

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 31 N/A INTRINSIC
Pfam:WBP-1 71 96 4.4e-6 PFAM
low complexity region 102 113 N/A INTRINSIC
low complexity region 171 189 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205023
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the first enzyme in the N-linked oligosaccharide processing pathway. The enzyme cleaves the distal alpha-1,2-linked glucose residue from the Glc(3)-Man(9)-GlcNAc(2) oligosaccharide precursor. This protein is located in the lumen of the endoplasmic reticulum. Defects in this gene are a cause of type IIb congenital disorder of glycosylation (CDGIIb). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,626,976 G701D probably damaging Het
6030468B19Rik T A 11: 117,802,954 N82K probably damaging Het
Abca17 A T 17: 24,335,590 V130E possibly damaging Het
Alpk2 T A 18: 65,266,277 K2077* probably null Het
Aox2 T C 1: 58,283,492 F73S probably benign Het
Ap3b1 T A 13: 94,532,034 C965* probably null Het
Arhgef10 T A 8: 14,930,030 V90E probably damaging Het
Atp5s A T 12: 69,741,788 N154Y probably benign Het
Atr T A 9: 95,869,900 H523Q probably benign Het
Bicdl1 G T 5: 115,651,857 Q511K possibly damaging Het
Capn15 A T 17: 25,965,254 N150K probably damaging Het
Card6 A T 15: 5,100,109 W602R probably benign Het
Clnk A T 5: 38,769,891 S82T possibly damaging Het
Cmah T C 13: 24,436,629 I282T probably damaging Het
Cog8 A G 8: 107,052,499 I382T probably benign Het
Dhrs7c G T 11: 67,809,896 probably null Het
Dhrs9 T A 2: 69,393,158 D83E probably damaging Het
Dmgdh G A 13: 93,715,535 G624E probably damaging Het
Dnajc30 C A 5: 135,064,715 F155L probably damaging Het
Drc7 A C 8: 95,074,150 K600T probably damaging Het
Efhb A C 17: 53,400,900 I745S probably damaging Het
Fasn T A 11: 120,810,465 K1988* probably null Het
Gad2 T C 2: 22,635,023 L273P probably damaging Het
Gm45861 A T 8: 27,542,508 K887* probably null Het
Gm45861 A T 8: 27,542,509 K887I unknown Het
Gm9195 A G 14: 72,480,781 Y152H probably damaging Het
Grip1 G A 10: 119,945,156 D237N probably damaging Het
Hamp A C 7: 30,942,536 C65G possibly damaging Het
Hes3 A G 4: 152,288,124 probably benign Het
Hgh1 T C 15: 76,370,450 I342T probably damaging Het
Hlcs T A 16: 94,268,164 K66* probably null Het
Ift80 A T 3: 68,990,944 C19* probably null Het
Ikbkap ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 4: 56,781,176 probably benign Het
Kbtbd12 C T 6: 88,618,668 C60Y probably damaging Het
Kdm4c T A 4: 74,345,567 V696E probably benign Het
Lect2 A G 13: 56,542,990 I117T unknown Het
Lipn T A 19: 34,076,990 Y209* probably null Het
Lpin3 G A 2: 160,898,707 V391I probably benign Het
Mocs2 A T 13: 114,824,607 I47L probably benign Het
Nbeal1 T A 1: 60,237,158 I686N probably damaging Het
Nbeal1 T A 1: 60,260,634 C1376* probably null Het
Ninl A G 2: 150,949,343 Y1087H possibly damaging Het
Olfr1076 T A 2: 86,509,025 C189S probably damaging Het
Olfr1338 A G 4: 118,754,418 V42A possibly damaging Het
Olfr518 A G 7: 108,881,268 F113L probably benign Het
Olfr623 A C 7: 103,660,581 L223R probably damaging Het
Olfr729 A G 14: 50,148,232 L214S probably damaging Het
Olfr750 A G 14: 51,071,159 V78A possibly damaging Het
Pkn1 A G 8: 83,671,734 F768S probably damaging Het
Plekha2 A G 8: 25,063,941 F82L probably damaging Het
Ppie T C 4: 123,135,107 E111G probably benign Het
Rps6ka5 T C 12: 100,581,420 Y277C probably damaging Het
Scgb2b12 A G 7: 32,326,677 V30A probably benign Het
Serac1 A T 17: 6,074,201 S16T probably benign Het
Sf3a3 T C 4: 124,722,900 Y192H probably damaging Het
Slc14a1 A G 18: 78,102,411 V436A probably benign Het
Smc3 T A 19: 53,641,898 M1112K probably damaging Het
Tnk2 G A 16: 32,681,168 G1017E probably damaging Het
Tnn T A 1: 160,126,377 K603* probably null Het
Trpm6 T C 19: 18,838,098 S1183P possibly damaging Het
Ttn A T 2: 76,784,380 V16964E possibly damaging Het
Usp17le G A 7: 104,768,489 T482I probably benign Het
Vmn1r219 T A 13: 23,163,355 M238K probably damaging Het
Wfs1 C T 5: 36,967,172 G792S probably benign Het
Xpa A T 4: 46,185,612 L122Q probably damaging Het
Other mutations in Mogs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Mogs APN 6 83118577 missense probably damaging 1.00
IGL02314:Mogs APN 6 83118055 missense probably benign 0.00
IGL02673:Mogs APN 6 83118218 missense probably damaging 1.00
IGL02862:Mogs APN 6 83115890 missense probably damaging 1.00
IGL02984:Mogs UTSW 6 83117315 missense probably benign 0.00
R1547:Mogs UTSW 6 83116025 missense possibly damaging 0.93
R1765:Mogs UTSW 6 83116803 missense probably benign 0.00
R2013:Mogs UTSW 6 83117650 nonsense probably null
R2015:Mogs UTSW 6 83117650 nonsense probably null
R3735:Mogs UTSW 6 83116776 missense possibly damaging 0.88
R3736:Mogs UTSW 6 83116776 missense possibly damaging 0.88
R4279:Mogs UTSW 6 83116067 missense probably damaging 1.00
R4585:Mogs UTSW 6 83118638 missense possibly damaging 0.56
R4586:Mogs UTSW 6 83118638 missense possibly damaging 0.56
R5783:Mogs UTSW 6 83118671 missense probably damaging 1.00
R5825:Mogs UTSW 6 83118212 missense possibly damaging 0.72
R6012:Mogs UTSW 6 83117382 missense probably damaging 1.00
R6753:Mogs UTSW 6 83115882 missense probably damaging 1.00
R7381:Mogs UTSW 6 83115632 missense unknown
R7485:Mogs UTSW 6 83116207 missense probably damaging 1.00
R7575:Mogs UTSW 6 83115835 missense probably damaging 1.00
R7659:Mogs UTSW 6 83116825 critical splice donor site probably null
R8162:Mogs UTSW 6 83115882 missense probably damaging 1.00
Z1176:Mogs UTSW 6 83116213 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACGTTCTAGCTGATAGTCGCC -3'
(R):5'- AAATGGCCTAGCTTTCCTTCTG -3'

Sequencing Primer
(F):5'- CTGATAGTCGCCATCTCTGGAG -3'
(R):5'- AGTACTCTTCAGCCATGATCAG -3'
Posted On2019-06-26