Incidental Mutation 'R7157:Kbtbd12'
ID557369
Institutional Source Beutler Lab
Gene Symbol Kbtbd12
Ensembl Gene ENSMUSG00000033182
Gene Namekelch repeat and BTB (POZ) domain containing 12
SynonymsKlhdc6, 4933428M03Rik, 4833415F11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R7157 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location88545114-88637950 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88618668 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 60 (C60Y)
Ref Sequence ENSEMBL: ENSMUSP00000139069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120933] [ENSMUST00000184664] [ENSMUST00000184878]
Predicted Effect probably damaging
Transcript: ENSMUST00000120933
AA Change: C60Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112581
Gene: ENSMUSG00000033182
AA Change: C60Y

DomainStartEndE-ValueType
BTB 29 126 1.39e-23 SMART
BACK 131 233 6.69e-30 SMART
Kelch 384 434 9.15e-3 SMART
Kelch 435 490 4.3e-8 SMART
Kelch 491 550 1.01e-1 SMART
Kelch 551 601 1.92e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184664
AA Change: C60Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139069
Gene: ENSMUSG00000033182
AA Change: C60Y

DomainStartEndE-ValueType
Pfam:BTB 19 77 6.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184878
SMART Domains Protein: ENSMUSP00000139333
Gene: ENSMUSG00000033182

DomainStartEndE-ValueType
Kelch 30 67 9.94e-1 SMART
Kelch 68 127 1.01e-1 SMART
Kelch 128 178 1.92e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,626,976 G701D probably damaging Het
6030468B19Rik T A 11: 117,802,954 N82K probably damaging Het
Abca17 A T 17: 24,335,590 V130E possibly damaging Het
Alpk2 T A 18: 65,266,277 K2077* probably null Het
Aox2 T C 1: 58,283,492 F73S probably benign Het
Ap3b1 T A 13: 94,532,034 C965* probably null Het
Arhgef10 T A 8: 14,930,030 V90E probably damaging Het
Atp5s A T 12: 69,741,788 N154Y probably benign Het
Atr T A 9: 95,869,900 H523Q probably benign Het
Bicdl1 G T 5: 115,651,857 Q511K possibly damaging Het
Capn15 A T 17: 25,965,254 N150K probably damaging Het
Card6 A T 15: 5,100,109 W602R probably benign Het
Clnk A T 5: 38,769,891 S82T possibly damaging Het
Cmah T C 13: 24,436,629 I282T probably damaging Het
Cog8 A G 8: 107,052,499 I382T probably benign Het
Dhrs7c G T 11: 67,809,896 probably null Het
Dhrs9 T A 2: 69,393,158 D83E probably damaging Het
Dmgdh G A 13: 93,715,535 G624E probably damaging Het
Dnajc30 C A 5: 135,064,715 F155L probably damaging Het
Drc7 A C 8: 95,074,150 K600T probably damaging Het
Efhb A C 17: 53,400,900 I745S probably damaging Het
Fasn T A 11: 120,810,465 K1988* probably null Het
Gad2 T C 2: 22,635,023 L273P probably damaging Het
Gm45861 A T 8: 27,542,508 K887* probably null Het
Gm45861 A T 8: 27,542,509 K887I unknown Het
Gm9195 A G 14: 72,480,781 Y152H probably damaging Het
Grip1 G A 10: 119,945,156 D237N probably damaging Het
Hamp A C 7: 30,942,536 C65G possibly damaging Het
Hes3 A G 4: 152,288,124 probably benign Het
Hgh1 T C 15: 76,370,450 I342T probably damaging Het
Hlcs T A 16: 94,268,164 K66* probably null Het
Ift80 A T 3: 68,990,944 C19* probably null Het
Ikbkap ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 4: 56,781,176 probably benign Het
Kdm4c T A 4: 74,345,567 V696E probably benign Het
Lect2 A G 13: 56,542,990 I117T unknown Het
Lipn T A 19: 34,076,990 Y209* probably null Het
Lpin3 G A 2: 160,898,707 V391I probably benign Het
Mocs2 A T 13: 114,824,607 I47L probably benign Het
Mogs T A 6: 83,118,507 H768Q probably benign Het
Nbeal1 T A 1: 60,237,158 I686N probably damaging Het
Nbeal1 T A 1: 60,260,634 C1376* probably null Het
Ninl A G 2: 150,949,343 Y1087H possibly damaging Het
Olfr1076 T A 2: 86,509,025 C189S probably damaging Het
Olfr1338 A G 4: 118,754,418 V42A possibly damaging Het
Olfr518 A G 7: 108,881,268 F113L probably benign Het
Olfr623 A C 7: 103,660,581 L223R probably damaging Het
Olfr729 A G 14: 50,148,232 L214S probably damaging Het
Olfr750 A G 14: 51,071,159 V78A possibly damaging Het
Pkn1 A G 8: 83,671,734 F768S probably damaging Het
Plekha2 A G 8: 25,063,941 F82L probably damaging Het
Ppie T C 4: 123,135,107 E111G probably benign Het
Rps6ka5 T C 12: 100,581,420 Y277C probably damaging Het
Scgb2b12 A G 7: 32,326,677 V30A probably benign Het
Serac1 A T 17: 6,074,201 S16T probably benign Het
Sf3a3 T C 4: 124,722,900 Y192H probably damaging Het
Slc14a1 A G 18: 78,102,411 V436A probably benign Het
Smc3 T A 19: 53,641,898 M1112K probably damaging Het
Tnk2 G A 16: 32,681,168 G1017E probably damaging Het
Tnn T A 1: 160,126,377 K603* probably null Het
Trpm6 T C 19: 18,838,098 S1183P possibly damaging Het
Ttn A T 2: 76,784,380 V16964E possibly damaging Het
Usp17le G A 7: 104,768,489 T482I probably benign Het
Vmn1r219 T A 13: 23,163,355 M238K probably damaging Het
Wfs1 C T 5: 36,967,172 G792S probably benign Het
Xpa A T 4: 46,185,612 L122Q probably damaging Het
Other mutations in Kbtbd12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01600:Kbtbd12 APN 6 88618558 missense probably benign 0.08
IGL01845:Kbtbd12 APN 6 88613940 missense probably benign 0.16
IGL02447:Kbtbd12 APN 6 88618694 missense probably damaging 1.00
IGL02623:Kbtbd12 APN 6 88618389 missense probably damaging 1.00
IGL02851:Kbtbd12 APN 6 88618329 missense probably benign 0.18
R0334:Kbtbd12 UTSW 6 88617906 missense probably damaging 0.99
R1689:Kbtbd12 UTSW 6 88618585 missense probably damaging 1.00
R1712:Kbtbd12 UTSW 6 88618694 missense probably damaging 1.00
R1777:Kbtbd12 UTSW 6 88618060 missense probably benign 0.00
R2037:Kbtbd12 UTSW 6 88617797 missense probably benign 0.00
R3967:Kbtbd12 UTSW 6 88618506 missense probably benign 0.01
R4660:Kbtbd12 UTSW 6 88617790 missense probably benign 0.44
R4785:Kbtbd12 UTSW 6 88618021 missense probably damaging 1.00
R5224:Kbtbd12 UTSW 6 88617699 intron probably benign
R5568:Kbtbd12 UTSW 6 88618627 missense probably damaging 1.00
R6051:Kbtbd12 UTSW 6 88617948 missense possibly damaging 0.69
R6412:Kbtbd12 UTSW 6 88618656 missense probably damaging 1.00
R6525:Kbtbd12 UTSW 6 88614080 missense probably benign 0.29
R6776:Kbtbd12 UTSW 6 88618266 missense probably damaging 0.97
R7046:Kbtbd12 UTSW 6 88618515 missense possibly damaging 0.89
R7224:Kbtbd12 UTSW 6 88613983 nonsense probably null
R7303:Kbtbd12 UTSW 6 88614112 missense unknown
Predicted Primers PCR Primer
(F):5'- ATTCCTATGCAGTTGGAGGC -3'
(R):5'- TACCATGGAGTGCAAGACTAAG -3'

Sequencing Primer
(F):5'- GGCATCCATGTGGTCCATCATATAG -3'
(R):5'- GGGGAAACACCAGCATAGCTTG -3'
Posted On2019-06-26