Mutagenetix > Incidental Mutations

Incidental Mutation 'R7157:Arhgef10'

557376

Institutional Source

Beutler Lab

Gene Symbol

Arhgef10

Ensembl Gene

ENSMUSG00000071176

Gene Name

Rho guanine nucleotide exchange factor (GEF) 10

Synonyms

6430549H08Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7157 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

14911663-15001085 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 14930030 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 90 (V90E)

Ref Sequence

ENSEMBL: ENSMUSP00000081225 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084207] [ENSMUST00000110800] [ENSMUST00000161162]

Predicted Effect

probably damaging
Transcript: ENSMUST00000084207
AA Change: V90E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000081225
Gene: ENSMUSG00000071176
AA Change: V90E

Domain	Start	End	E-Value	Type
low complexity region	73	82	N/A	INTRINSIC
low complexity region	155	165	N/A	INTRINSIC
low complexity region	236	245	N/A	INTRINSIC
low complexity region	247	265	N/A	INTRINSIC
coiled coil region	308	335	N/A	INTRINSIC
RhoGEF	401	583	9.79e-58	SMART
Blast:PH	617	829	6e-47	BLAST
low complexity region	1256	1272	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110800
AA Change: V90E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106424
Gene: ENSMUSG00000071176
AA Change: V90E

Domain	Start	End	E-Value	Type
low complexity region	73	82	N/A	INTRINSIC
low complexity region	155	165	N/A	INTRINSIC
low complexity region	236	245	N/A	INTRINSIC
low complexity region	247	265	N/A	INTRINSIC
low complexity region	280	291	N/A	INTRINSIC
RhoGEF	362	544	9.79e-58	SMART
Blast:PH	578	790	8e-47	BLAST
low complexity region	1217	1233	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000161162
AA Change: V90E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125606
Gene: ENSMUSG00000071176
AA Change: V90E

Domain	Start	End	E-Value	Type
low complexity region	73	82	N/A	INTRINSIC
low complexity region	155	165	N/A	INTRINSIC
low complexity region	235	244	N/A	INTRINSIC
low complexity region	246	264	N/A	INTRINSIC
coiled coil region	307	334	N/A	INTRINSIC
RhoGEF	400	579	2.2e-51	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Rho guanine nucleotide exchange factor (GEF). Rho GEFs regulate the activity of small Rho GTPases by stimulating the exchange of guanine diphosphate (GDP) for guanine triphosphate (GTP) and may play a role in neural morphogenesis. Mutations in this gene are associated with slowed nerve conduction velocity (SNCV). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	G	A	7: 41,626,976	G701D	probably damaging	Het
6030468B19Rik	T	A	11: 117,802,954	N82K	probably damaging	Het
Abca17	A	T	17: 24,335,590	V130E	possibly damaging	Het
Alpk2	T	A	18: 65,266,277	K2077*	probably null	Het
Aox2	T	C	1: 58,283,492	F73S	probably benign	Het
Ap3b1	T	A	13: 94,532,034	C965*	probably null	Het
Atp5s	A	T	12: 69,741,788	N154Y	probably benign	Het
Atr	T	A	9: 95,869,900	H523Q	probably benign	Het
Bicdl1	G	T	5: 115,651,857	Q511K	possibly damaging	Het
Capn15	A	T	17: 25,965,254	N150K	probably damaging	Het
Card6	A	T	15: 5,100,109	W602R	probably benign	Het
Clnk	A	T	5: 38,769,891	S82T	possibly damaging	Het
Cmah	T	C	13: 24,436,629	I282T	probably damaging	Het
Cog8	A	G	8: 107,052,499	I382T	probably benign	Het
Dhrs7c	G	T	11: 67,809,896		probably null	Het
Dhrs9	T	A	2: 69,393,158	D83E	probably damaging	Het
Dmgdh	G	A	13: 93,715,535	G624E	probably damaging	Het
Dnajc30	C	A	5: 135,064,715	F155L	probably damaging	Het
Drc7	A	C	8: 95,074,150	K600T	probably damaging	Het
Efhb	A	C	17: 53,400,900	I745S	probably damaging	Het
Fasn	T	A	11: 120,810,465	K1988*	probably null	Het
Gad2	T	C	2: 22,635,023	L273P	probably damaging	Het
Gm45861	A	T	8: 27,542,508	K887*	probably null	Het
Gm45861	A	T	8: 27,542,509	K887I	unknown	Het
Gm9195	A	G	14: 72,480,781	Y152H	probably damaging	Het
Grip1	G	A	10: 119,945,156	D237N	probably damaging	Het
Hamp	A	C	7: 30,942,536	C65G	possibly damaging	Het
Hes3	A	G	4: 152,288,124		probably benign	Het
Hgh1	T	C	15: 76,370,450	I342T	probably damaging	Het
Hlcs	T	A	16: 94,268,164	K66*	probably null	Het
Ift80	A	T	3: 68,990,944	C19*	probably null	Het
Ikbkap	ACTTCTTCTTCTTCTTCTTCTTC	ACTTCTTCTTCTTCTTCTTC	4: 56,781,176		probably benign	Het
Kbtbd12	C	T	6: 88,618,668	C60Y	probably damaging	Het
Kdm4c	T	A	4: 74,345,567	V696E	probably benign	Het
Lect2	A	G	13: 56,542,990	I117T	unknown	Het
Lipn	T	A	19: 34,076,990	Y209*	probably null	Het
Lpin3	G	A	2: 160,898,707	V391I	probably benign	Het
Mocs2	A	T	13: 114,824,607	I47L	probably benign	Het
Mogs	T	A	6: 83,118,507	H768Q	probably benign	Het
Nbeal1	T	A	1: 60,237,158	I686N	probably damaging	Het
Nbeal1	T	A	1: 60,260,634	C1376*	probably null	Het
Ninl	A	G	2: 150,949,343	Y1087H	possibly damaging	Het
Olfr1076	T	A	2: 86,509,025	C189S	probably damaging	Het
Olfr1338	A	G	4: 118,754,418	V42A	possibly damaging	Het
Olfr518	A	G	7: 108,881,268	F113L	probably benign	Het
Olfr623	A	C	7: 103,660,581	L223R	probably damaging	Het
Olfr729	A	G	14: 50,148,232	L214S	probably damaging	Het
Olfr750	A	G	14: 51,071,159	V78A	possibly damaging	Het
Pkn1	A	G	8: 83,671,734	F768S	probably damaging	Het
Plekha2	A	G	8: 25,063,941	F82L	probably damaging	Het
Ppie	T	C	4: 123,135,107	E111G	probably benign	Het
Rps6ka5	T	C	12: 100,581,420	Y277C	probably damaging	Het
Scgb2b12	A	G	7: 32,326,677	V30A	probably benign	Het
Serac1	A	T	17: 6,074,201	S16T	probably benign	Het
Sf3a3	T	C	4: 124,722,900	Y192H	probably damaging	Het
Slc14a1	A	G	18: 78,102,411	V436A	probably benign	Het
Smc3	T	A	19: 53,641,898	M1112K	probably damaging	Het
Tnk2	G	A	16: 32,681,168	G1017E	probably damaging	Het
Tnn	T	A	1: 160,126,377	K603*	probably null	Het
Trpm6	T	C	19: 18,838,098	S1183P	possibly damaging	Het
Ttn	A	T	2: 76,784,380	V16964E	possibly damaging	Het
Usp17le	G	A	7: 104,768,489	T482I	probably benign	Het
Vmn1r219	T	A	13: 23,163,355	M238K	probably damaging	Het
Wfs1	C	T	5: 36,967,172	G792S	probably benign	Het
Xpa	A	T	4: 46,185,612	L122Q	probably damaging	Het

Other mutations in Arhgef10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00766:Arhgef10	APN	8	14975006	missense	probably damaging	1.00
IGL00823:Arhgef10	APN	8	14940378	unclassified	probably benign
IGL01012:Arhgef10	APN	8	14979977	missense	probably damaging	0.99
IGL01311:Arhgef10	APN	8	14991054	splice site	probably null
IGL01596:Arhgef10	APN	8	14999468	nonsense	probably null
IGL01888:Arhgef10	APN	8	14962577	nonsense	probably null
IGL01938:Arhgef10	APN	8	14991062	missense	probably benign	0.09
IGL02151:Arhgef10	APN	8	14928889	missense	possibly damaging	0.77
IGL02274:Arhgef10	APN	8	14947205	missense	probably damaging	0.99
IGL02369:Arhgef10	APN	8	14997551	missense	probably damaging	1.00
IGL02411:Arhgef10	APN	8	14954819	missense	probably benign	0.01
IGL02500:Arhgef10	APN	8	14961238	missense	probably damaging	1.00
IGL02597:Arhgef10	APN	8	14930198	missense	probably benign	0.27
IGL02602:Arhgef10	APN	8	14930198	missense	probably benign	0.27
IGL02743:Arhgef10	APN	8	14930198	missense	probably benign	0.27
IGL02744:Arhgef10	APN	8	14930198	missense	probably benign	0.27
IGL03113:Arhgef10	APN	8	14954505	missense	probably damaging	1.00
IGL03248:Arhgef10	APN	8	14928847	missense	probably benign	0.00
P0028:Arhgef10	UTSW	8	14928925	missense	possibly damaging	0.79
P4748:Arhgef10	UTSW	8	14928925	missense	possibly damaging	0.79
R0049:Arhgef10	UTSW	8	14954446	missense	probably damaging	1.00
R0197:Arhgef10	UTSW	8	14962636	missense	probably damaging	1.00
R0479:Arhgef10	UTSW	8	14991070	missense	probably damaging	0.98
R0701:Arhgef10	UTSW	8	14962636	missense	probably damaging	1.00
R0966:Arhgef10	UTSW	8	14940343	missense	probably benign	0.01
R1367:Arhgef10	UTSW	8	14940225	missense	probably damaging	1.00
R1572:Arhgef10	UTSW	8	14991211	missense	possibly damaging	0.53
R1631:Arhgef10	UTSW	8	14947157	missense	probably damaging	0.98
R1766:Arhgef10	UTSW	8	14979836	missense	probably damaging	1.00
R1920:Arhgef10	UTSW	8	14956987	splice site	probably benign
R2051:Arhgef10	UTSW	8	14945320	missense	probably null	1.00
R2088:Arhgef10	UTSW	8	14983898	missense	possibly damaging	0.46
R2118:Arhgef10	UTSW	8	14934820	missense	probably damaging	0.99
R2120:Arhgef10	UTSW	8	14934820	missense	probably damaging	0.99
R2121:Arhgef10	UTSW	8	14934820	missense	probably damaging	0.99
R2122:Arhgef10	UTSW	8	14934820	missense	probably damaging	0.99
R2124:Arhgef10	UTSW	8	14934820	missense	probably damaging	0.99
R2318:Arhgef10	UTSW	8	14928855	missense	probably damaging	1.00
R2870:Arhgef10	UTSW	8	14975093	critical splice donor site	probably null
R2870:Arhgef10	UTSW	8	14975666	missense	probably benign	0.01
R2870:Arhgef10	UTSW	8	14975093	critical splice donor site	probably null
R2870:Arhgef10	UTSW	8	14975666	missense	probably benign	0.01
R2872:Arhgef10	UTSW	8	14975093	critical splice donor site	probably null
R2872:Arhgef10	UTSW	8	14975666	missense	probably benign	0.01
R2872:Arhgef10	UTSW	8	14975093	critical splice donor site	probably null
R2872:Arhgef10	UTSW	8	14975666	missense	probably benign	0.01
R2874:Arhgef10	UTSW	8	14975093	critical splice donor site	probably null
R2874:Arhgef10	UTSW	8	14975666	missense	probably benign	0.01
R3522:Arhgef10	UTSW	8	14954918	missense	probably damaging	1.00
R4049:Arhgef10	UTSW	8	14979998	missense	probably benign	0.05
R4324:Arhgef10	UTSW	8	14940335	missense	possibly damaging	0.77
R4351:Arhgef10	UTSW	8	14991145	nonsense	probably null
R4384:Arhgef10	UTSW	8	14930157	nonsense	probably null
R4385:Arhgef10	UTSW	8	14930157	nonsense	probably null
R4685:Arhgef10	UTSW	8	14956963	missense	probably damaging	1.00
R5111:Arhgef10	UTSW	8	14932408	missense	probably benign	0.00
R5169:Arhgef10	UTSW	8	14930051	missense	possibly damaging	0.80
R5670:Arhgef10	UTSW	8	14954774	missense	probably benign	0.01
R5945:Arhgef10	UTSW	8	14980028	critical splice donor site	probably null
R6593:Arhgef10	UTSW	8	14962522	missense	probably damaging	1.00
R6593:Arhgef10	UTSW	8	14962564	missense	possibly damaging	0.82
R6734:Arhgef10	UTSW	8	14975053	missense	probably damaging	1.00
R6859:Arhgef10	UTSW	8	14975005	missense	probably damaging	1.00
R6890:Arhgef10	UTSW	8	14928786	missense	probably benign	0.27
R7068:Arhgef10	UTSW	8	14958639	missense	probably damaging	1.00
R7081:Arhgef10	UTSW	8	14997547	nonsense	probably null
R7232:Arhgef10	UTSW	8	14940323	missense	probably benign	0.10
R7514:Arhgef10	UTSW	8	14975956	missense	probably benign	0.16
R7544:Arhgef10	UTSW	8	14979854	missense	probably benign	0.34
R7657:Arhgef10	UTSW	8	14979893	missense	probably damaging	1.00
R7736:Arhgef10	UTSW	8	14980583	nonsense	probably null
R7777:Arhgef10	UTSW	8	14945373	missense	probably damaging	1.00
R8000:Arhgef10	UTSW	8	14930054	missense	probably damaging	1.00
R8060:Arhgef10	UTSW	8	14954446	missense	probably damaging	1.00
R8441:Arhgef10	UTSW	8	14991237	splice site	probably benign
R8545:Arhgef10	UTSW	8	14928868	missense	probably benign	0.00
R8545:Arhgef10	UTSW	8	14975931	missense	possibly damaging	0.83
X0024:Arhgef10	UTSW	8	14978486	missense	probably benign	0.01
X0027:Arhgef10	UTSW	8	14997631	missense	possibly damaging	0.92
Z1088:Arhgef10	UTSW	8	14964191	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CAATGGTGTACCCCACAGAC -3'
(R):5'- TCGGATGATGACAGGACTGG -3'

Sequencing Primer
(F):5'- GTGTACCCCACAGACCTGGAC -3'
(R):5'- CTGGAGTAGGCAGGCAGC -3'

Posted On

2019-06-26