Incidental Mutation 'R0586:Olfr1240'
ID55738
Institutional Source Beutler Lab
Gene Symbol Olfr1240
Ensembl Gene ENSMUSG00000111174
Gene Nameolfactory receptor 1240
SynonymsMOR231-8, GA_x6K02T2Q125-50883183-50882239
MMRRC Submission 038776-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R0586 (G1)
Quality Score204
Status Validated
Chromosome2
Chromosomal Location89436296-89443000 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89439354 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 308 (R308S)
Ref Sequence ENSEMBL: ENSMUSP00000150256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000215362] [ENSMUST00000216123]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099779
AA Change: R308S

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097367
Gene: ENSMUSG00000075087
AA Change: R308S

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 4e-45 PFAM
Pfam:7tm_1 39 285 1.7e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000187363
AA Change: R308S

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000139968
Gene: ENSMUSG00000099909
AA Change: R308S

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 2e-28 PFAM
Pfam:7tm_4 137 278 1.2e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215362
AA Change: R308S

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216123
AA Change: R308S

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.5%
  • 20x: 94.4%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,137,091 V145D probably damaging Het
Abca1 A T 4: 53,092,860 V308E probably benign Het
Amy1 A G 3: 113,562,769 probably benign Het
Astn2 C T 4: 66,185,142 V345M unknown Het
Brwd1 T C 16: 96,043,086 E756G probably damaging Het
Ccpg1 C T 9: 73,001,821 L135F probably benign Het
Cecr2 C T 6: 120,757,884 H694Y probably damaging Het
Cfh G A 1: 140,183,182 T14I probably damaging Het
Cfhr2 G A 1: 139,813,434 R268* probably null Het
Clca1 T A 3: 145,032,589 I53L probably benign Het
Clcn6 A G 4: 148,038,749 probably benign Het
Cnfn C T 7: 25,367,831 V98I probably benign Het
Cntnap1 C T 11: 101,187,014 R1122W probably damaging Het
Cpne9 A T 6: 113,295,063 E384V probably damaging Het
Ctr9 T C 7: 111,049,498 probably benign Het
Ctsj T A 13: 61,003,701 probably benign Het
Cyp2c39 A C 19: 39,513,490 probably benign Het
Dock5 A C 14: 67,809,032 I767S probably damaging Het
Eftud2 T C 11: 102,846,620 T552A probably damaging Het
Epdr1 A G 13: 19,594,545 I25T probably damaging Het
Fam160a2 T C 7: 105,389,447 E195G probably damaging Het
Fam208b A G 13: 3,590,321 L272P probably damaging Het
Fcgbp A T 7: 28,089,713 D568V probably damaging Het
Frem2 T A 3: 53,647,921 T1732S probably damaging Het
Fuz T C 7: 44,898,558 V183A possibly damaging Het
Grb7 T C 11: 98,453,220 S284P probably damaging Het
Hoxb4 G T 11: 96,318,887 G40C probably damaging Het
Kcnn1 T C 8: 70,863,869 probably benign Het
Kmt2d C A 15: 98,835,207 probably benign Het
L3mbtl3 A G 10: 26,327,834 V366A unknown Het
Ldlr G A 9: 21,739,744 R486H probably benign Het
Lnpep A T 17: 17,575,396 probably benign Het
Mical3 A T 6: 121,029,641 probably benign Het
Myh15 T C 16: 49,171,887 probably benign Het
Nup155 T A 15: 8,130,232 H542Q probably benign Het
Olfr1100 T C 2: 86,978,782 N5D probably damaging Het
Olfr53 T C 7: 140,652,063 F28S probably benign Het
Olfr780 A G 10: 129,322,047 I141M probably benign Het
Olfr967 A T 9: 39,751,118 H244L probably damaging Het
Opn4 A G 14: 34,598,973 probably benign Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Parp14 T C 16: 35,841,012 K1522R probably benign Het
Pkhd1 A T 1: 20,524,111 D1259E probably benign Het
Pogz C T 3: 94,879,353 A1084V probably damaging Het
Popdc3 G A 10: 45,315,263 V157M probably benign Het
Prrt4 T C 6: 29,171,184 Y423C probably damaging Het
Qrich1 C T 9: 108,534,520 H415Y probably damaging Het
Rabgap1 A G 2: 37,543,223 N801D probably benign Het
Rb1 A G 14: 73,287,684 probably benign Het
Rp1 A T 1: 4,347,837 N1017K possibly damaging Het
Ryr2 T C 13: 11,635,559 D356G probably null Het
Skint8 C G 4: 111,936,929 P172R probably damaging Het
Slc12a8 T G 16: 33,658,230 M643R possibly damaging Het
Sult1c1 A T 17: 53,964,085 probably benign Het
Tcaf1 T A 6: 42,673,539 M869L probably damaging Het
Tecpr1 T C 5: 144,217,401 N78S probably damaging Het
Tectb A T 19: 55,181,924 Y69F probably damaging Het
Them4 A T 3: 94,329,794 N187I possibly damaging Het
Tm9sf3 A G 19: 41,256,143 probably null Het
Tnik G T 3: 28,577,361 probably benign Het
Tns2 G T 15: 102,109,585 probably benign Het
Tnxb A G 17: 34,672,144 D487G probably damaging Het
Trim33 T A 3: 103,310,344 C202S probably damaging Het
Trpm2 T A 10: 77,923,516 I1145F probably damaging Het
Trpv2 A G 11: 62,592,770 T478A probably benign Het
Ube2e3 T C 2: 78,919,990 Y187H probably benign Het
Ubxn11 A G 4: 134,109,652 R64G possibly damaging Het
Wwtr1 T C 3: 57,459,066 T407A probably damaging Het
Zfyve26 A T 12: 79,268,728 S1325T possibly damaging Het
Other mutations in Olfr1240
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01765:Olfr1240 APN 2 89439800 missense probably benign 0.00
IGL01767:Olfr1240 APN 2 89439800 missense probably benign 0.00
R0375:Olfr1240 UTSW 2 89439396 missense probably benign 0.00
R0417:Olfr1240 UTSW 2 89440175 missense possibly damaging 0.88
R0501:Olfr1240 UTSW 2 89439716 missense probably benign 0.09
R0624:Olfr1240 UTSW 2 89440138 missense possibly damaging 0.94
R1168:Olfr1240 UTSW 2 89439869 nonsense probably null
R1728:Olfr1240 UTSW 2 89439583 missense probably benign 0.00
R1729:Olfr1240 UTSW 2 89439583 missense probably benign 0.00
R1730:Olfr1240 UTSW 2 89439583 missense probably benign 0.00
R1739:Olfr1240 UTSW 2 89439583 missense probably benign 0.00
R1762:Olfr1240 UTSW 2 89439583 missense probably benign 0.00
R1783:Olfr1240 UTSW 2 89439583 missense probably benign 0.00
R1785:Olfr1240 UTSW 2 89439583 missense probably benign 0.00
R2038:Olfr1240 UTSW 2 89439345 missense probably benign 0.00
R2049:Olfr1240 UTSW 2 89439583 missense probably benign 0.00
R2069:Olfr1240 UTSW 2 89439583 missense probably benign 0.00
R2140:Olfr1240 UTSW 2 89439583 missense probably benign 0.00
R2142:Olfr1240 UTSW 2 89439583 missense probably benign 0.00
R2215:Olfr1240 UTSW 2 89440037 missense probably benign 0.00
R3714:Olfr1240 UTSW 2 89439383 missense probably damaging 1.00
R4304:Olfr1240 UTSW 2 89440198 missense probably damaging 0.96
R4437:Olfr1240 UTSW 2 89439354 missense possibly damaging 0.55
R4825:Olfr1240 UTSW 2 89439865 missense probably benign 0.01
R4857:Olfr1240 UTSW 2 89439623 missense probably damaging 1.00
R4865:Olfr1240 UTSW 2 89439659 missense possibly damaging 0.88
R5588:Olfr1240 UTSW 2 89439416 missense probably damaging 1.00
R5730:Olfr1240 UTSW 2 89439436 missense probably damaging 1.00
R7206:Olfr1240 UTSW 2 89440457 start gained probably benign
R7365:Olfr1240 UTSW 2 89440198 missense probably benign 0.01
R7574:Olfr1240 UTSW 2 89439401 missense possibly damaging 0.94
R8007:Olfr1240 UTSW 2 89440340
R8268:Olfr1240 UTSW 2 89439436 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAATCCCCAAACTGAGCAGGT -3'
(R):5'- GCTCCCACATCATAGTGGTTGTCC -3'

Sequencing Primer
(F):5'- GCAGGTATAAAAATCTGCCATGC -3'
(R):5'- CATCATAGTGGTTGTCCTCTTTTTTG -3'
Posted On2013-07-11