Incidental Mutation 'R7157:Abca17'
ID 557404
Institutional Source Beutler Lab
Gene Symbol Abca17
Ensembl Gene ENSMUSG00000035435
Gene Name ATP-binding cassette, sub-family A member 17
Synonyms
MMRRC Submission 045258-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7157 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 24483233-24570042 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 24554564 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 130 (V130E)
Ref Sequence ENSEMBL: ENSMUSP00000046218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]
AlphaFold E9PX95
Predicted Effect possibly damaging
Transcript: ENSMUST00000039324
AA Change: V130E

PolyPhen 2 Score 0.457 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435
AA Change: V130E

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
transmembrane domain 22 44 N/A INTRINSIC
Pfam:ABC2_membrane_3 252 464 9.5e-17 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 6.7e-35 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121226
AA Change: V130E

PolyPhen 2 Score 0.457 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435
AA Change: V130E

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:ABC2_membrane_3 21 464 1.2e-15 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 1.1e-32 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,276,400 (GRCm39) G701D probably damaging Het
6030468B19Rik T A 11: 117,693,780 (GRCm39) N82K probably damaging Het
Alpk2 T A 18: 65,399,348 (GRCm39) K2077* probably null Het
Aox1 T C 1: 58,322,651 (GRCm39) F73S probably benign Het
Ap3b1 T A 13: 94,668,542 (GRCm39) C965* probably null Het
Arhgef10 T A 8: 14,980,030 (GRCm39) V90E probably damaging Het
Atr T A 9: 95,751,953 (GRCm39) H523Q probably benign Het
Bicdl1 G T 5: 115,789,916 (GRCm39) Q511K possibly damaging Het
Capn15 A T 17: 26,184,228 (GRCm39) N150K probably damaging Het
Card6 A T 15: 5,129,591 (GRCm39) W602R probably benign Het
Clnk A T 5: 38,927,234 (GRCm39) S82T possibly damaging Het
Cmah T C 13: 24,620,612 (GRCm39) I282T probably damaging Het
Cog8 A G 8: 107,779,131 (GRCm39) I382T probably benign Het
Dhrs7c G T 11: 67,700,722 (GRCm39) probably null Het
Dhrs9 T A 2: 69,223,502 (GRCm39) D83E probably damaging Het
Dmac2l A T 12: 69,788,562 (GRCm39) N154Y probably benign Het
Dmgdh G A 13: 93,852,043 (GRCm39) G624E probably damaging Het
Dnajc30 C A 5: 135,093,569 (GRCm39) F155L probably damaging Het
Drc7 A C 8: 95,800,778 (GRCm39) K600T probably damaging Het
Efhb A C 17: 53,707,928 (GRCm39) I745S probably damaging Het
Elp1 ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 4: 56,781,176 (GRCm39) probably benign Het
Fasn T A 11: 120,701,291 (GRCm39) K1988* probably null Het
Gad2 T C 2: 22,525,035 (GRCm39) L273P probably damaging Het
Gm45861 A T 8: 28,032,536 (GRCm39) K887* probably null Het
Gm45861 A T 8: 28,032,537 (GRCm39) K887I unknown Het
Gm9195 A G 14: 72,718,221 (GRCm39) Y152H probably damaging Het
Grip1 G A 10: 119,781,061 (GRCm39) D237N probably damaging Het
Hamp A C 7: 30,641,961 (GRCm39) C65G possibly damaging Het
Hes3 A G 4: 152,372,581 (GRCm39) probably benign Het
Hgh1 T C 15: 76,254,650 (GRCm39) I342T probably damaging Het
Hlcs T A 16: 94,069,023 (GRCm39) K66* probably null Het
Ift80 A T 3: 68,898,277 (GRCm39) C19* probably null Het
Kbtbd12 C T 6: 88,595,650 (GRCm39) C60Y probably damaging Het
Kdm4c T A 4: 74,263,804 (GRCm39) V696E probably benign Het
Lect2 A G 13: 56,690,803 (GRCm39) I117T unknown Het
Lipn T A 19: 34,054,390 (GRCm39) Y209* probably null Het
Lpin3 G A 2: 160,740,627 (GRCm39) V391I probably benign Het
Mocs2 A T 13: 114,961,143 (GRCm39) I47L probably benign Het
Mogs T A 6: 83,095,488 (GRCm39) H768Q probably benign Het
Nbeal1 T A 1: 60,276,317 (GRCm39) I686N probably damaging Het
Nbeal1 T A 1: 60,299,793 (GRCm39) C1376* probably null Het
Ninl A G 2: 150,791,263 (GRCm39) Y1087H possibly damaging Het
Or10a3 A G 7: 108,480,475 (GRCm39) F113L probably benign Het
Or10ak14 A G 4: 118,611,615 (GRCm39) V42A possibly damaging Het
Or4k5 A G 14: 50,385,689 (GRCm39) L214S probably damaging Het
Or51b6b A C 7: 103,309,788 (GRCm39) L223R probably damaging Het
Or6s1 A G 14: 51,308,616 (GRCm39) V78A possibly damaging Het
Or8k30 T A 2: 86,339,369 (GRCm39) C189S probably damaging Het
Pkn1 A G 8: 84,398,363 (GRCm39) F768S probably damaging Het
Plekha2 A G 8: 25,553,957 (GRCm39) F82L probably damaging Het
Ppie T C 4: 123,028,900 (GRCm39) E111G probably benign Het
Rps6ka5 T C 12: 100,547,679 (GRCm39) Y277C probably damaging Het
Scgb2b12 A G 7: 32,026,102 (GRCm39) V30A probably benign Het
Serac1 A T 17: 6,124,476 (GRCm39) S16T probably benign Het
Sf3a3 T C 4: 124,616,693 (GRCm39) Y192H probably damaging Het
Slc14a1 A G 18: 78,145,626 (GRCm39) V436A probably benign Het
Smc3 T A 19: 53,630,329 (GRCm39) M1112K probably damaging Het
Tnk2 G A 16: 32,499,986 (GRCm39) G1017E probably damaging Het
Tnn T A 1: 159,953,947 (GRCm39) K603* probably null Het
Trpm6 T C 19: 18,815,462 (GRCm39) S1183P possibly damaging Het
Ttn A T 2: 76,614,724 (GRCm39) V16964E possibly damaging Het
Usp17le G A 7: 104,417,696 (GRCm39) T482I probably benign Het
Vmn1r219 T A 13: 23,347,525 (GRCm39) M238K probably damaging Het
Wfs1 C T 5: 37,124,516 (GRCm39) G792S probably benign Het
Xpa A T 4: 46,185,612 (GRCm39) L122Q probably damaging Het
Other mutations in Abca17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca17 APN 17 24,514,165 (GRCm39) missense probably benign 0.14
IGL00585:Abca17 APN 17 24,519,294 (GRCm39) missense probably damaging 0.99
IGL00941:Abca17 APN 17 24,536,104 (GRCm39) missense probably damaging 1.00
IGL01987:Abca17 APN 17 24,565,202 (GRCm39) missense probably benign 0.00
IGL01988:Abca17 APN 17 24,553,229 (GRCm39) missense probably damaging 0.99
IGL02223:Abca17 APN 17 24,506,909 (GRCm39) nonsense probably null
IGL02368:Abca17 APN 17 24,506,767 (GRCm39) missense probably benign 0.01
IGL02405:Abca17 APN 17 24,498,036 (GRCm39) missense possibly damaging 0.80
IGL02431:Abca17 APN 17 24,517,958 (GRCm39) missense probably benign 0.05
IGL02607:Abca17 APN 17 24,546,679 (GRCm39) nonsense probably null
IGL02706:Abca17 APN 17 24,517,966 (GRCm39) missense probably benign 0.00
IGL02729:Abca17 APN 17 24,499,455 (GRCm39) missense probably benign 0.06
IGL02818:Abca17 APN 17 24,519,326 (GRCm39) missense probably benign 0.02
IGL02891:Abca17 APN 17 24,500,340 (GRCm39) missense probably damaging 0.99
IGL03236:Abca17 APN 17 24,545,450 (GRCm39) splice site probably benign
IGL03299:Abca17 APN 17 24,484,565 (GRCm39) missense probably damaging 1.00
basin UTSW 17 24,537,159 (GRCm39) missense probably benign 0.01
Bowl UTSW 17 24,536,212 (GRCm39) missense probably benign 0.09
R0018:Abca17 UTSW 17 24,532,162 (GRCm39) splice site probably null
R0467:Abca17 UTSW 17 24,532,151 (GRCm39) splice site probably benign
R0671:Abca17 UTSW 17 24,500,223 (GRCm39) missense probably benign 0.00
R1175:Abca17 UTSW 17 24,508,325 (GRCm39) missense possibly damaging 0.91
R1397:Abca17 UTSW 17 24,504,733 (GRCm39) missense probably benign 0.18
R1398:Abca17 UTSW 17 24,547,511 (GRCm39) missense probably damaging 0.96
R1678:Abca17 UTSW 17 24,554,594 (GRCm39) missense probably benign 0.05
R1696:Abca17 UTSW 17 24,486,632 (GRCm39) missense possibly damaging 0.90
R1781:Abca17 UTSW 17 24,486,531 (GRCm39) missense possibly damaging 0.95
R1845:Abca17 UTSW 17 24,486,690 (GRCm39) missense probably damaging 1.00
R1970:Abca17 UTSW 17 24,526,549 (GRCm39) missense probably benign 0.00
R1997:Abca17 UTSW 17 24,504,700 (GRCm39) missense probably benign 0.02
R2141:Abca17 UTSW 17 24,553,240 (GRCm39) missense probably benign 0.00
R2199:Abca17 UTSW 17 24,554,598 (GRCm39) missense probably benign 0.19
R2394:Abca17 UTSW 17 24,500,190 (GRCm39) splice site probably null
R2442:Abca17 UTSW 17 24,547,606 (GRCm39) missense probably benign 0.02
R2509:Abca17 UTSW 17 24,508,587 (GRCm39) splice site probably benign
R2848:Abca17 UTSW 17 24,508,481 (GRCm39) missense probably damaging 0.96
R2849:Abca17 UTSW 17 24,508,481 (GRCm39) missense probably damaging 0.96
R2859:Abca17 UTSW 17 24,500,288 (GRCm39) missense possibly damaging 0.46
R2879:Abca17 UTSW 17 24,508,481 (GRCm39) missense probably damaging 0.96
R2935:Abca17 UTSW 17 24,508,481 (GRCm39) missense probably damaging 0.96
R3153:Abca17 UTSW 17 24,547,720 (GRCm39) missense probably damaging 1.00
R3154:Abca17 UTSW 17 24,547,720 (GRCm39) missense probably damaging 1.00
R3434:Abca17 UTSW 17 24,508,511 (GRCm39) missense probably damaging 1.00
R3695:Abca17 UTSW 17 24,508,481 (GRCm39) missense probably damaging 0.96
R3905:Abca17 UTSW 17 24,515,257 (GRCm39) missense probably benign 0.13
R4282:Abca17 UTSW 17 24,518,034 (GRCm39) missense possibly damaging 0.49
R4334:Abca17 UTSW 17 24,537,242 (GRCm39) missense probably damaging 1.00
R4350:Abca17 UTSW 17 24,498,020 (GRCm39) critical splice donor site probably null
R4548:Abca17 UTSW 17 24,553,245 (GRCm39) missense possibly damaging 0.82
R4626:Abca17 UTSW 17 24,540,058 (GRCm39) missense probably damaging 1.00
R4722:Abca17 UTSW 17 24,484,403 (GRCm39) missense probably damaging 1.00
R4745:Abca17 UTSW 17 24,526,427 (GRCm39) missense probably damaging 1.00
R4818:Abca17 UTSW 17 24,536,135 (GRCm39) missense probably damaging 0.98
R5279:Abca17 UTSW 17 24,508,388 (GRCm39) missense probably damaging 1.00
R5310:Abca17 UTSW 17 24,500,204 (GRCm39) missense probably benign 0.00
R5320:Abca17 UTSW 17 24,526,541 (GRCm39) missense probably damaging 1.00
R5435:Abca17 UTSW 17 24,486,588 (GRCm39) missense possibly damaging 0.90
R5622:Abca17 UTSW 17 24,546,642 (GRCm39) missense probably benign 0.14
R5776:Abca17 UTSW 17 24,514,132 (GRCm39) missense probably benign 0.09
R5928:Abca17 UTSW 17 24,537,159 (GRCm39) missense probably benign 0.01
R6013:Abca17 UTSW 17 24,506,820 (GRCm39) missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24,500,219 (GRCm39) missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24,500,219 (GRCm39) missense possibly damaging 0.79
R6052:Abca17 UTSW 17 24,537,165 (GRCm39) missense probably benign 0.00
R6063:Abca17 UTSW 17 24,483,318 (GRCm39) missense unknown
R6404:Abca17 UTSW 17 24,484,892 (GRCm39) missense probably benign 0.13
R6746:Abca17 UTSW 17 24,565,195 (GRCm39) nonsense probably null
R6819:Abca17 UTSW 17 24,506,767 (GRCm39) missense probably benign 0.01
R6828:Abca17 UTSW 17 24,545,389 (GRCm39) missense possibly damaging 0.91
R7043:Abca17 UTSW 17 24,484,474 (GRCm39) missense probably damaging 1.00
R7065:Abca17 UTSW 17 24,546,725 (GRCm39) missense probably damaging 1.00
R7123:Abca17 UTSW 17 24,484,949 (GRCm39) missense probably damaging 1.00
R7188:Abca17 UTSW 17 24,554,600 (GRCm39) missense possibly damaging 0.89
R7294:Abca17 UTSW 17 24,539,983 (GRCm39) missense not run
R7352:Abca17 UTSW 17 24,508,028 (GRCm39) nonsense probably null
R7355:Abca17 UTSW 17 24,486,621 (GRCm39) missense probably benign 0.00
R7358:Abca17 UTSW 17 24,510,529 (GRCm39) missense probably benign 0.00
R7411:Abca17 UTSW 17 24,547,543 (GRCm39) missense possibly damaging 0.52
R7915:Abca17 UTSW 17 24,484,507 (GRCm39) missense probably damaging 1.00
R8039:Abca17 UTSW 17 24,547,699 (GRCm39) missense probably damaging 1.00
R8095:Abca17 UTSW 17 24,536,196 (GRCm39) missense possibly damaging 0.77
R8308:Abca17 UTSW 17 24,486,657 (GRCm39) missense probably damaging 1.00
R8517:Abca17 UTSW 17 24,536,207 (GRCm39) missense probably benign 0.00
R8811:Abca17 UTSW 17 24,536,212 (GRCm39) missense probably benign 0.09
R8819:Abca17 UTSW 17 24,547,576 (GRCm39) missense probably damaging 1.00
R8820:Abca17 UTSW 17 24,547,576 (GRCm39) missense probably damaging 1.00
R8953:Abca17 UTSW 17 24,518,015 (GRCm39) missense probably benign
R9095:Abca17 UTSW 17 24,500,370 (GRCm39) missense probably damaging 0.97
R9313:Abca17 UTSW 17 24,565,207 (GRCm39) missense probably benign 0.00
R9314:Abca17 UTSW 17 24,547,593 (GRCm39) missense possibly damaging 0.91
R9347:Abca17 UTSW 17 24,483,479 (GRCm39) missense probably benign
R9351:Abca17 UTSW 17 24,510,751 (GRCm39) missense probably benign 0.00
R9387:Abca17 UTSW 17 24,553,255 (GRCm39) missense probably benign 0.02
R9388:Abca17 UTSW 17 24,483,273 (GRCm39) missense unknown
R9440:Abca17 UTSW 17 24,499,452 (GRCm39) missense probably benign 0.02
R9498:Abca17 UTSW 17 24,484,480 (GRCm39) missense probably damaging 1.00
R9654:Abca17 UTSW 17 24,536,099 (GRCm39) missense probably benign 0.09
R9709:Abca17 UTSW 17 24,517,934 (GRCm39) missense probably benign
R9770:Abca17 UTSW 17 24,514,121 (GRCm39) missense probably benign 0.00
R9773:Abca17 UTSW 17 24,508,565 (GRCm39) missense probably damaging 1.00
RF024:Abca17 UTSW 17 24,506,706 (GRCm39) frame shift probably null
RF029:Abca17 UTSW 17 24,506,701 (GRCm39) critical splice donor site probably benign
RF032:Abca17 UTSW 17 24,506,701 (GRCm39) frame shift probably null
RF036:Abca17 UTSW 17 24,506,701 (GRCm39) critical splice donor site probably benign
X0017:Abca17 UTSW 17 24,536,137 (GRCm39) missense probably benign 0.26
X0065:Abca17 UTSW 17 24,553,258 (GRCm39) missense probably damaging 1.00
Z1088:Abca17 UTSW 17 24,498,081 (GRCm39) missense probably benign 0.03
Z1088:Abca17 UTSW 17 24,498,053 (GRCm39) missense probably damaging 0.96
Z1088:Abca17 UTSW 17 24,565,193 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTCCTCGAAAAGACAACGGAGTG -3'
(R):5'- AAGCTGGAGTCTCAAGTGTC -3'

Sequencing Primer
(F):5'- TGAGTTGCAAAACGTGAACCTG -3'
(R):5'- AAGCTGGAGTCTCAAGTGTCCTTAG -3'
Posted On 2019-06-26