Incidental Mutation 'R7157:Trpm6'
ID557409
Institutional Source Beutler Lab
Gene Symbol Trpm6
Ensembl Gene ENSMUSG00000024727
Gene Nametransient receptor potential cation channel, subfamily M, member 6
SynonymsCHAK2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7157 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location18749983-18892510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18838098 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1183 (S1183P)
Ref Sequence ENSEMBL: ENSMUSP00000037443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040489]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040489
AA Change: S1183P

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: S1183P

DomainStartEndE-ValueType
Blast:ANK 430 459 4e-8 BLAST
low complexity region 580 604 N/A INTRINSIC
transmembrane domain 749 766 N/A INTRINSIC
Pfam:Ion_trans 847 1087 2.8e-13 PFAM
low complexity region 1113 1126 N/A INTRINSIC
low complexity region 1136 1154 N/A INTRINSIC
Pfam:TRPM_tetra 1176 1231 7.5e-27 PFAM
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1578 1596 N/A INTRINSIC
Blast:Alpha_kinase 1618 1673 9e-11 BLAST
low complexity region 1682 1695 N/A INTRINSIC
Alpha_kinase 1761 1978 1e-84 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,626,976 G701D probably damaging Het
6030468B19Rik T A 11: 117,802,954 N82K probably damaging Het
Abca17 A T 17: 24,335,590 V130E possibly damaging Het
Alpk2 T A 18: 65,266,277 K2077* probably null Het
Aox2 T C 1: 58,283,492 F73S probably benign Het
Ap3b1 T A 13: 94,532,034 C965* probably null Het
Arhgef10 T A 8: 14,930,030 V90E probably damaging Het
Atp5s A T 12: 69,741,788 N154Y probably benign Het
Atr T A 9: 95,869,900 H523Q probably benign Het
Bicdl1 G T 5: 115,651,857 Q511K possibly damaging Het
Capn15 A T 17: 25,965,254 N150K probably damaging Het
Card6 A T 15: 5,100,109 W602R probably benign Het
Clnk A T 5: 38,769,891 S82T possibly damaging Het
Cmah T C 13: 24,436,629 I282T probably damaging Het
Cog8 A G 8: 107,052,499 I382T probably benign Het
Dhrs7c G T 11: 67,809,896 probably null Het
Dhrs9 T A 2: 69,393,158 D83E probably damaging Het
Dmgdh G A 13: 93,715,535 G624E probably damaging Het
Dnajc30 C A 5: 135,064,715 F155L probably damaging Het
Drc7 A C 8: 95,074,150 K600T probably damaging Het
Efhb A C 17: 53,400,900 I745S probably damaging Het
Fasn T A 11: 120,810,465 K1988* probably null Het
Gad2 T C 2: 22,635,023 L273P probably damaging Het
Gm45861 A T 8: 27,542,508 K887* probably null Het
Gm45861 A T 8: 27,542,509 K887I unknown Het
Gm9195 A G 14: 72,480,781 Y152H probably damaging Het
Grip1 G A 10: 119,945,156 D237N probably damaging Het
Hamp A C 7: 30,942,536 C65G possibly damaging Het
Hes3 A G 4: 152,288,124 probably benign Het
Hgh1 T C 15: 76,370,450 I342T probably damaging Het
Hlcs T A 16: 94,268,164 K66* probably null Het
Ift80 A T 3: 68,990,944 C19* probably null Het
Ikbkap ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 4: 56,781,176 probably benign Het
Kbtbd12 C T 6: 88,618,668 C60Y probably damaging Het
Kdm4c T A 4: 74,345,567 V696E probably benign Het
Lect2 A G 13: 56,542,990 I117T unknown Het
Lipn T A 19: 34,076,990 Y209* probably null Het
Lpin3 G A 2: 160,898,707 V391I probably benign Het
Mocs2 A T 13: 114,824,607 I47L probably benign Het
Mogs T A 6: 83,118,507 H768Q probably benign Het
Nbeal1 T A 1: 60,237,158 I686N probably damaging Het
Nbeal1 T A 1: 60,260,634 C1376* probably null Het
Ninl A G 2: 150,949,343 Y1087H possibly damaging Het
Olfr1076 T A 2: 86,509,025 C189S probably damaging Het
Olfr1338 A G 4: 118,754,418 V42A possibly damaging Het
Olfr518 A G 7: 108,881,268 F113L probably benign Het
Olfr623 A C 7: 103,660,581 L223R probably damaging Het
Olfr729 A G 14: 50,148,232 L214S probably damaging Het
Olfr750 A G 14: 51,071,159 V78A possibly damaging Het
Pkn1 A G 8: 83,671,734 F768S probably damaging Het
Plekha2 A G 8: 25,063,941 F82L probably damaging Het
Ppie T C 4: 123,135,107 E111G probably benign Het
Rps6ka5 T C 12: 100,581,420 Y277C probably damaging Het
Scgb2b12 A G 7: 32,326,677 V30A probably benign Het
Serac1 A T 17: 6,074,201 S16T probably benign Het
Sf3a3 T C 4: 124,722,900 Y192H probably damaging Het
Slc14a1 A G 18: 78,102,411 V436A probably benign Het
Smc3 T A 19: 53,641,898 M1112K probably damaging Het
Tnk2 G A 16: 32,681,168 G1017E probably damaging Het
Tnn T A 1: 160,126,377 K603* probably null Het
Ttn A T 2: 76,784,380 V16964E possibly damaging Het
Usp17le G A 7: 104,768,489 T482I probably benign Het
Vmn1r219 T A 13: 23,163,355 M238K probably damaging Het
Wfs1 C T 5: 36,967,172 G792S probably benign Het
Xpa A T 4: 46,185,612 L122Q probably damaging Het
Other mutations in Trpm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Trpm6 APN 19 18783908 splice site probably benign
IGL00862:Trpm6 APN 19 18827528 missense probably damaging 1.00
IGL01348:Trpm6 APN 19 18877651 missense probably damaging 1.00
IGL01400:Trpm6 APN 19 18825794 nonsense probably null
IGL01451:Trpm6 APN 19 18809569 missense probably damaging 1.00
IGL01508:Trpm6 APN 19 18796530 nonsense probably null
IGL01995:Trpm6 APN 19 18830327 splice site probably benign
IGL02092:Trpm6 APN 19 18772331 missense possibly damaging 0.59
IGL02152:Trpm6 APN 19 18832539 missense possibly damaging 0.93
IGL02294:Trpm6 APN 19 18854063 missense probably benign
IGL02329:Trpm6 APN 19 18854217 missense probably benign 0.17
IGL02366:Trpm6 APN 19 18778510 splice site probably benign
IGL02402:Trpm6 APN 19 18786756 missense probably benign 0.18
IGL02457:Trpm6 APN 19 18825791 missense probably damaging 1.00
IGL02457:Trpm6 APN 19 18827398 nonsense probably null
IGL02684:Trpm6 APN 19 18802207 splice site probably benign
IGL02705:Trpm6 APN 19 18776733 critical splice donor site probably null
IGL02728:Trpm6 APN 19 18809652 missense possibly damaging 0.71
IGL02742:Trpm6 APN 19 18830012 splice site probably benign
IGL02818:Trpm6 APN 19 18866257 missense probably benign 0.04
IGL02836:Trpm6 APN 19 18813482 missense probably damaging 1.00
IGL03119:Trpm6 APN 19 18838017 nonsense probably null
IGL03193:Trpm6 APN 19 18825872 missense possibly damaging 0.94
IGL03227:Trpm6 APN 19 18819119 missense probably benign 0.01
IGL03227:Trpm6 APN 19 18786779 missense probably benign 0.12
IGL03231:Trpm6 APN 19 18819181 missense probably benign
IGL03245:Trpm6 APN 19 18877701 missense probably damaging 1.00
IGL03328:Trpm6 APN 19 18838082 missense possibly damaging 0.94
IGL03341:Trpm6 APN 19 18813486 missense probably benign
P0043:Trpm6 UTSW 19 18877765 missense probably damaging 1.00
PIT4260001:Trpm6 UTSW 19 18825802 missense possibly damaging 0.48
R0057:Trpm6 UTSW 19 18786755 missense probably benign 0.05
R0115:Trpm6 UTSW 19 18829952 missense probably damaging 0.98
R0119:Trpm6 UTSW 19 18832593 missense probably benign 0.05
R0140:Trpm6 UTSW 19 18819194 splice site probably null
R0267:Trpm6 UTSW 19 18823378 missense probably benign
R0350:Trpm6 UTSW 19 18883957 splice site probably null
R0373:Trpm6 UTSW 19 18853587 missense probably benign 0.15
R0393:Trpm6 UTSW 19 18778644 missense probably damaging 0.99
R0416:Trpm6 UTSW 19 18783025 splice site probably benign
R0505:Trpm6 UTSW 19 18873902 splice site probably benign
R0526:Trpm6 UTSW 19 18792876 missense probably damaging 0.97
R0607:Trpm6 UTSW 19 18872221 missense probably benign 0.00
R0609:Trpm6 UTSW 19 18825862 missense probably damaging 0.97
R0714:Trpm6 UTSW 19 18838087 missense possibly damaging 0.90
R1215:Trpm6 UTSW 19 18796498 missense probably damaging 1.00
R1474:Trpm6 UTSW 19 18796495 missense probably benign 0.28
R1512:Trpm6 UTSW 19 18875931 missense probably benign
R1558:Trpm6 UTSW 19 18786828 missense probably benign 0.04
R1597:Trpm6 UTSW 19 18827524 missense probably damaging 0.98
R1618:Trpm6 UTSW 19 18877631 missense possibly damaging 0.88
R1779:Trpm6 UTSW 19 18856217 missense probably damaging 1.00
R1796:Trpm6 UTSW 19 18827567 missense possibly damaging 0.90
R1799:Trpm6 UTSW 19 18891999 splice site probably null
R1840:Trpm6 UTSW 19 18866267 missense probably benign 0.21
R1991:Trpm6 UTSW 19 18796284 missense probably benign 0.00
R2030:Trpm6 UTSW 19 18854265 missense probably benign
R2073:Trpm6 UTSW 19 18876042 missense probably damaging 1.00
R2074:Trpm6 UTSW 19 18877739 missense probably damaging 1.00
R2096:Trpm6 UTSW 19 18825752 missense probably damaging 0.97
R2103:Trpm6 UTSW 19 18796284 missense probably benign 0.00
R2106:Trpm6 UTSW 19 18813350 missense possibly damaging 0.95
R2117:Trpm6 UTSW 19 18829952 missense probably damaging 0.98
R2850:Trpm6 UTSW 19 18792090 missense possibly damaging 0.68
R3125:Trpm6 UTSW 19 18854431 missense probably benign 0.05
R3719:Trpm6 UTSW 19 18772393 nonsense probably null
R3779:Trpm6 UTSW 19 18876039 missense possibly damaging 0.80
R4115:Trpm6 UTSW 19 18832557 missense probably damaging 1.00
R4367:Trpm6 UTSW 19 18827525 missense probably damaging 0.99
R4523:Trpm6 UTSW 19 18796500 missense probably damaging 1.00
R4546:Trpm6 UTSW 19 18832477 missense probably damaging 1.00
R4564:Trpm6 UTSW 19 18832597 missense possibly damaging 0.95
R4565:Trpm6 UTSW 19 18825872 missense probably damaging 1.00
R4697:Trpm6 UTSW 19 18853791 missense probably benign 0.01
R4714:Trpm6 UTSW 19 18854200 missense possibly damaging 0.93
R4750:Trpm6 UTSW 19 18876064 missense probably damaging 0.99
R4771:Trpm6 UTSW 19 18813493 missense probably damaging 0.97
R4791:Trpm6 UTSW 19 18867981 missense probably benign 0.00
R4814:Trpm6 UTSW 19 18862212 missense probably benign 0.11
R5028:Trpm6 UTSW 19 18786760 missense probably damaging 1.00
R5237:Trpm6 UTSW 19 18813464 missense probably damaging 1.00
R5615:Trpm6 UTSW 19 18829933 missense probably damaging 0.96
R5642:Trpm6 UTSW 19 18830207 missense probably damaging 1.00
R5645:Trpm6 UTSW 19 18853604 missense probably damaging 1.00
R5726:Trpm6 UTSW 19 18853617 missense probably damaging 1.00
R5832:Trpm6 UTSW 19 18786819 missense possibly damaging 0.66
R5843:Trpm6 UTSW 19 18856175 missense probably benign 0.04
R5955:Trpm6 UTSW 19 18892019 missense possibly damaging 0.75
R6101:Trpm6 UTSW 19 18853748 nonsense probably null
R6105:Trpm6 UTSW 19 18853748 nonsense probably null
R6211:Trpm6 UTSW 19 18783128 missense probably damaging 1.00
R6228:Trpm6 UTSW 19 18854291 missense probably damaging 1.00
R6263:Trpm6 UTSW 19 18854108 missense possibly damaging 0.94
R6453:Trpm6 UTSW 19 18829990 missense probably damaging 1.00
R6562:Trpm6 UTSW 19 18838042 missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18796439 critical splice acceptor site probably null
R6624:Trpm6 UTSW 19 18889020 missense probably damaging 1.00
R6729:Trpm6 UTSW 19 18830297 missense probably damaging 1.00
R6765:Trpm6 UTSW 19 18877765 missense probably damaging 1.00
R6976:Trpm6 UTSW 19 18783163 missense probably benign
R7103:Trpm6 UTSW 19 18813547 missense possibly damaging 0.87
R7126:Trpm6 UTSW 19 18854033 nonsense probably null
R7128:Trpm6 UTSW 19 18811773 missense possibly damaging 0.92
R7212:Trpm6 UTSW 19 18853791 missense probably benign 0.01
R7263:Trpm6 UTSW 19 18876786 missense probably damaging 1.00
R7268:Trpm6 UTSW 19 18778585 missense probably benign 0.13
R7305:Trpm6 UTSW 19 18876091 missense probably benign 0.30
R7498:Trpm6 UTSW 19 18876120 missense probably damaging 1.00
R7558:Trpm6 UTSW 19 18778665 missense probably damaging 0.96
R7590:Trpm6 UTSW 19 18832581 missense probably benign 0.31
R7646:Trpm6 UTSW 19 18867961 missense probably benign 0.10
R7650:Trpm6 UTSW 19 18876013 missense possibly damaging 0.70
R7727:Trpm6 UTSW 19 18854249 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGGAACACAATCCATGTCTGC -3'
(R):5'- GTCAGCTTACTTGAATATCCTGTC -3'

Sequencing Primer
(F):5'- ACTACATCTCAGCTCTCCAAGAATG -3'
(R):5'- CCCTTGGAATGCAAAGACTGTCTAG -3'
Posted On2019-06-26