Incidental Mutation 'R7158:Fezf1'
ID 557429
Institutional Source Beutler Lab
Gene Symbol Fezf1
Ensembl Gene ENSMUSG00000029697
Gene Name Fez family zinc finger 1
Synonyms Zfp312-like, 3110069A13Rik, Fez
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7158 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 23245044-23248362 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 23245790 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 459 (T459A)
Ref Sequence ENSEMBL: ENSMUSP00000031709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031709]
AlphaFold Q0VDQ9
Predicted Effect probably benign
Transcript: ENSMUST00000031709
AA Change: T459A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031709
Gene: ENSMUSG00000029697
AA Change: T459A

DomainStartEndE-ValueType
low complexity region 102 114 N/A INTRINSIC
ZnF_C2H2 260 282 1.58e-3 SMART
ZnF_C2H2 288 310 3.39e-3 SMART
ZnF_C2H2 316 338 1.38e-3 SMART
ZnF_C2H2 344 366 2.57e-3 SMART
ZnF_C2H2 372 394 2.53e-2 SMART
ZnF_C2H2 400 423 1.38e-3 SMART
low complexity region 441 467 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional repressor that belongs to the zinc finger double domain protein family. The encoded protein is thought to play a role in the embryonic migration of gonadotropin-releasing hormone neurons into the brain. Mutations in this gene are associated with hypogonadotropic hypogonadism-22 with anosmia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a null mutation of this gene display neonatal lethality, impaired olfactory bulb development and impaired olfactory bulb interneuron migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,273,982 M454L probably benign Het
Abca8b T A 11: 109,934,589 E1595V probably damaging Het
Actr5 T A 2: 158,626,414 C155S possibly damaging Het
Acvr1b T A 15: 101,194,058 V73E probably benign Het
Add2 T C 6: 86,085,952 Y31H probably damaging Het
Akap13 G T 7: 75,579,594 V92F probably damaging Het
Alox8 T A 11: 69,185,870 M568L probably benign Het
Birc6 A T 17: 74,594,376 E1145V probably benign Het
Cacng1 A T 11: 107,703,839 M166K probably damaging Het
Ces1f A G 8: 93,268,016 F256L probably benign Het
Clpb A G 7: 101,663,832 R8G probably benign Het
Col6a5 A G 9: 105,864,208 V2504A possibly damaging Het
Coq8a T C 1: 180,179,184 D93G probably benign Het
Cry2 A T 2: 92,413,715 I371N probably damaging Het
Ddx43 A C 9: 78,412,219 Q276H probably damaging Het
Dock10 T C 1: 80,586,872 probably null Het
Dst A G 1: 34,274,285 T4378A probably benign Het
Gm10097 C T 10: 5,069,407 A72V unknown Het
Hydin A G 8: 110,609,671 S5027G possibly damaging Het
Inhbb A T 1: 119,421,022 L22* probably null Het
Kat8 G A 7: 127,922,159 G228S probably benign Het
Kif15 T A 9: 122,999,314 S897T probably benign Het
Kndc1 A G 7: 139,931,860 Y1460C possibly damaging Het
Krt78 T A 15: 101,951,806 D225V probably benign Het
Lama3 A T 18: 12,456,812 I800F probably benign Het
Mdn1 C A 4: 32,725,121 T2580K probably benign Het
Mest T C 6: 30,744,914 F201S possibly damaging Het
Mtmr9 A G 14: 63,526,869 F470L probably benign Het
Nfic C T 10: 81,420,605 R75Q probably damaging Het
Nme2 G A 11: 93,955,658 probably benign Het
Nrg4 A G 9: 55,242,100 L71P probably damaging Het
Pacsin2 C T 15: 83,379,742 E365K possibly damaging Het
Pappa T C 4: 65,204,867 I813T possibly damaging Het
Pcdhgb4 A G 18: 37,720,885 E111G probably damaging Het
Pdzd8 C T 19: 59,300,157 R937H probably damaging Het
Per1 T G 11: 69,104,104 probably benign Het
Pex2 A G 3: 5,561,336 F138L probably benign Het
Pold1 A T 7: 44,538,866 N529K probably damaging Het
Pou6f2 T C 13: 18,152,038 I316V Het
Prom1 A C 5: 44,012,913 I682S probably damaging Het
Prpf40a T C 2: 53,152,553 K481E probably damaging Het
Prrg4 A T 2: 104,832,613 V216E probably damaging Het
Ptch2 C T 4: 117,114,784 P1168S possibly damaging Het
Pvr C A 7: 19,918,637 E118* probably null Het
R3hcc1l C T 19: 42,583,429 P716S probably damaging Het
Rasa4 A G 5: 136,102,021 E382G probably damaging Het
Rbp3 T A 14: 33,955,556 M487K probably benign Het
Rsad2 A T 12: 26,450,780 probably null Het
Shmt1 T C 11: 60,790,242 I353V probably benign Het
Shprh C T 10: 11,166,730 T819I probably damaging Het
Skap1 T A 11: 96,526,057 F56Y possibly damaging Het
Slc22a16 G T 10: 40,573,741 V79L possibly damaging Het
Slc34a1 A G 13: 55,401,231 T165A probably damaging Het
Smchd1 A C 17: 71,400,150 I941R probably damaging Het
Syne1 C A 10: 5,057,931 V98F probably damaging Het
Tcaim A G 9: 122,818,990 D190G possibly damaging Het
Tdrd9 G C 12: 112,036,366 E816D probably benign Het
Tmem132d T C 5: 128,137,019 K326E possibly damaging Het
Uhrf1bp1 T A 17: 27,886,433 C644* probably null Het
Usp35 T C 7: 97,325,964 M1V probably null Het
Wdr62 C T 7: 30,270,738 V215I possibly damaging Het
Zan T C 5: 137,400,644 T4153A unknown Het
Zfp239 G T 6: 117,871,729 E143* probably null Het
Zfp292 T C 4: 34,808,679 D1460G probably benign Het
Zfp647 C T 15: 76,917,305 G90R probably benign Het
Other mutations in Fezf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fezf1 APN 6 23247843 missense possibly damaging 0.76
IGL02538:Fezf1 APN 6 23246558 missense probably damaging 1.00
IGL02983:Fezf1 APN 6 23247872 missense probably damaging 0.99
IGL03372:Fezf1 APN 6 23246910 missense probably damaging 1.00
R0494:Fezf1 UTSW 6 23246055 missense probably damaging 1.00
R0612:Fezf1 UTSW 6 23247029 missense probably damaging 1.00
R0836:Fezf1 UTSW 6 23246999 missense probably benign 0.01
R1930:Fezf1 UTSW 6 23246907 missense probably damaging 1.00
R1931:Fezf1 UTSW 6 23246907 missense probably damaging 1.00
R2103:Fezf1 UTSW 6 23247332 missense possibly damaging 0.55
R2104:Fezf1 UTSW 6 23247332 missense possibly damaging 0.55
R2233:Fezf1 UTSW 6 23246003 missense probably damaging 1.00
R3404:Fezf1 UTSW 6 23247284 missense probably benign 0.13
R3950:Fezf1 UTSW 6 23247420 nonsense probably null
R4209:Fezf1 UTSW 6 23246617 missense probably damaging 0.99
R4400:Fezf1 UTSW 6 23247710 missense probably benign 0.22
R4614:Fezf1 UTSW 6 23247858 missense possibly damaging 0.71
R5287:Fezf1 UTSW 6 23248011 missense probably benign
R5878:Fezf1 UTSW 6 23247581 missense possibly damaging 0.71
R5943:Fezf1 UTSW 6 23246949 nonsense probably null
R5952:Fezf1 UTSW 6 23247428 missense probably benign 0.08
R6663:Fezf1 UTSW 6 23247528 missense probably damaging 1.00
R7184:Fezf1 UTSW 6 23247836 missense probably benign 0.31
R8679:Fezf1 UTSW 6 23247770 missense probably benign
R9294:Fezf1 UTSW 6 23245798 missense possibly damaging 0.96
X0025:Fezf1 UTSW 6 23247909 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTAGCAGGTGCATGCAAGAG -3'
(R):5'- AAGAAGCCTTTCACCTGCCC -3'

Sequencing Primer
(F):5'- ATGTAGAGGCATCCGGTCCTC -3'
(R):5'- TCACCTGCCCCACGTGTG -3'
Posted On 2019-06-26