Incidental Mutation 'R0586:Trim33'
ID55743
Institutional Source Beutler Lab
Gene Symbol Trim33
Ensembl Gene ENSMUSG00000033014
Gene Nametripartite motif-containing 33
Synonymsectodermin, Ecto, 8030451N04Rik, Tif1g
MMRRC Submission 038776-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0586 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location103279293-103358775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103310344 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 202 (C202S)
Ref Sequence ENSEMBL: ENSMUSP00000102473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029444] [ENSMUST00000106860]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029444
AA Change: C202S

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029444
Gene: ENSMUSG00000033014
AA Change: C202S

DomainStartEndE-ValueType
low complexity region 6 31 N/A INTRINSIC
low complexity region 33 134 N/A INTRINSIC
PHD 138 199 9.85e0 SMART
RING 139 198 2.12e-8 SMART
BBOX 226 273 1.24e-9 SMART
RING 231 293 2.01e0 SMART
BBOX 285 326 1.54e-10 SMART
BBC 333 459 7.55e-45 SMART
low complexity region 540 583 N/A INTRINSIC
low complexity region 731 773 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
PHD 902 945 4.15e-11 SMART
BROMO 972 1095 3.74e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106860
AA Change: C202S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102473
Gene: ENSMUSG00000033014
AA Change: C202S

DomainStartEndE-ValueType
low complexity region 6 31 N/A INTRINSIC
low complexity region 33 134 N/A INTRINSIC
PHD 138 199 9.85e0 SMART
RING 139 198 2.12e-8 SMART
BBOX 226 273 1.24e-9 SMART
RING 231 293 2.01e0 SMART
BBOX 285 326 1.54e-10 SMART
BBC 333 459 7.55e-45 SMART
low complexity region 540 583 N/A INTRINSIC
low complexity region 731 773 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
PHD 902 945 4.15e-11 SMART
BROMO 972 1078 3.52e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197779
Meta Mutation Damage Score 0.2266 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.5%
  • 20x: 94.4%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a transcriptional corepressor. However, molecules that interact with this protein have not yet been identified. The protein is a member of the tripartite motif family. This motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. Three alternatively spliced transcript variants for this gene have been described, however, the full-length nature of one variant has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E9.5 with abnormal embryonic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,137,091 V145D probably damaging Het
Abca1 A T 4: 53,092,860 V308E probably benign Het
Amy1 A G 3: 113,562,769 probably benign Het
Astn2 C T 4: 66,185,142 V345M unknown Het
Brwd1 T C 16: 96,043,086 E756G probably damaging Het
Ccpg1 C T 9: 73,001,821 L135F probably benign Het
Cecr2 C T 6: 120,757,884 H694Y probably damaging Het
Cfh G A 1: 140,183,182 T14I probably damaging Het
Cfhr2 G A 1: 139,813,434 R268* probably null Het
Clca1 T A 3: 145,032,589 I53L probably benign Het
Clcn6 A G 4: 148,038,749 probably benign Het
Cnfn C T 7: 25,367,831 V98I probably benign Het
Cntnap1 C T 11: 101,187,014 R1122W probably damaging Het
Cpne9 A T 6: 113,295,063 E384V probably damaging Het
Ctr9 T C 7: 111,049,498 probably benign Het
Ctsj T A 13: 61,003,701 probably benign Het
Cyp2c39 A C 19: 39,513,490 probably benign Het
Dock5 A C 14: 67,809,032 I767S probably damaging Het
Eftud2 T C 11: 102,846,620 T552A probably damaging Het
Epdr1 A G 13: 19,594,545 I25T probably damaging Het
Fam160a2 T C 7: 105,389,447 E195G probably damaging Het
Fam208b A G 13: 3,590,321 L272P probably damaging Het
Fcgbp A T 7: 28,089,713 D568V probably damaging Het
Frem2 T A 3: 53,647,921 T1732S probably damaging Het
Fuz T C 7: 44,898,558 V183A possibly damaging Het
Grb7 T C 11: 98,453,220 S284P probably damaging Het
Hoxb4 G T 11: 96,318,887 G40C probably damaging Het
Kcnn1 T C 8: 70,863,869 probably benign Het
Kmt2d C A 15: 98,835,207 probably benign Het
L3mbtl3 A G 10: 26,327,834 V366A unknown Het
Ldlr G A 9: 21,739,744 R486H probably benign Het
Lnpep A T 17: 17,575,396 probably benign Het
Mical3 A T 6: 121,029,641 probably benign Het
Myh15 T C 16: 49,171,887 probably benign Het
Nup155 T A 15: 8,130,232 H542Q probably benign Het
Olfr1100 T C 2: 86,978,782 N5D probably damaging Het
Olfr1240 T A 2: 89,439,354 R308S possibly damaging Het
Olfr53 T C 7: 140,652,063 F28S probably benign Het
Olfr780 A G 10: 129,322,047 I141M probably benign Het
Olfr967 A T 9: 39,751,118 H244L probably damaging Het
Opn4 A G 14: 34,598,973 probably benign Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Parp14 T C 16: 35,841,012 K1522R probably benign Het
Pkhd1 A T 1: 20,524,111 D1259E probably benign Het
Pogz C T 3: 94,879,353 A1084V probably damaging Het
Popdc3 G A 10: 45,315,263 V157M probably benign Het
Prrt4 T C 6: 29,171,184 Y423C probably damaging Het
Qrich1 C T 9: 108,534,520 H415Y probably damaging Het
Rabgap1 A G 2: 37,543,223 N801D probably benign Het
Rb1 A G 14: 73,287,684 probably benign Het
Rp1 A T 1: 4,347,837 N1017K possibly damaging Het
Ryr2 T C 13: 11,635,559 D356G probably null Het
Skint8 C G 4: 111,936,929 P172R probably damaging Het
Slc12a8 T G 16: 33,658,230 M643R possibly damaging Het
Sult1c1 A T 17: 53,964,085 probably benign Het
Tcaf1 T A 6: 42,673,539 M869L probably damaging Het
Tecpr1 T C 5: 144,217,401 N78S probably damaging Het
Tectb A T 19: 55,181,924 Y69F probably damaging Het
Them4 A T 3: 94,329,794 N187I possibly damaging Het
Tm9sf3 A G 19: 41,256,143 probably null Het
Tnik G T 3: 28,577,361 probably benign Het
Tns2 G T 15: 102,109,585 probably benign Het
Tnxb A G 17: 34,672,144 D487G probably damaging Het
Trpm2 T A 10: 77,923,516 I1145F probably damaging Het
Trpv2 A G 11: 62,592,770 T478A probably benign Het
Ube2e3 T C 2: 78,919,990 Y187H probably benign Het
Ubxn11 A G 4: 134,109,652 R64G possibly damaging Het
Wwtr1 T C 3: 57,459,066 T407A probably damaging Het
Zfyve26 A T 12: 79,268,728 S1325T possibly damaging Het
Other mutations in Trim33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Trim33 APN 3 103330182 missense probably benign 0.44
IGL00981:Trim33 APN 3 103351995 splice site probably benign
IGL01010:Trim33 APN 3 103346715 nonsense probably null
IGL01025:Trim33 APN 3 103353918 utr 3 prime probably benign
IGL01082:Trim33 APN 3 103326859 missense possibly damaging 0.49
IGL02245:Trim33 APN 3 103346770 critical splice donor site probably null
IGL02291:Trim33 APN 3 103326865 missense probably damaging 1.00
IGL03248:Trim33 APN 3 103310973 unclassified probably benign
IGL03400:Trim33 APN 3 103329143 missense probably damaging 0.99
abilene UTSW 3 103321559 missense probably damaging 0.99
Bemoaned UTSW 3 103326793 missense possibly damaging 0.92
Excision UTSW 3 103344576 missense probably damaging 1.00
Peaked UTSW 3 103337532 critical splice donor site probably null
Pike UTSW 3 103310885 missense probably damaging 0.98
westworld UTSW 3 103326901 missense possibly damaging 0.46
R0143:Trim33 UTSW 3 103352101 missense probably benign 0.00
R0471:Trim33 UTSW 3 103326901 missense possibly damaging 0.46
R0513:Trim33 UTSW 3 103310384 missense probably damaging 1.00
R0573:Trim33 UTSW 3 103351990 splice site probably benign
R1103:Trim33 UTSW 3 103310885 missense probably damaging 0.98
R1157:Trim33 UTSW 3 103353830 missense probably damaging 1.00
R1328:Trim33 UTSW 3 103353597 missense possibly damaging 0.86
R1331:Trim33 UTSW 3 103310354 missense probably damaging 0.99
R1385:Trim33 UTSW 3 103310950 missense possibly damaging 0.46
R1397:Trim33 UTSW 3 103310434 unclassified probably benign
R1785:Trim33 UTSW 3 103329220 frame shift probably null
R1848:Trim33 UTSW 3 103324640 unclassified probably benign
R1903:Trim33 UTSW 3 103337444 missense probably damaging 1.00
R3404:Trim33 UTSW 3 103321559 missense probably damaging 0.99
R3878:Trim33 UTSW 3 103352005 missense probably damaging 1.00
R4156:Trim33 UTSW 3 103310314 missense possibly damaging 0.94
R4281:Trim33 UTSW 3 103329086 missense probably damaging 0.99
R4570:Trim33 UTSW 3 103330165 missense probably damaging 0.96
R4809:Trim33 UTSW 3 103329256 missense possibly damaging 0.91
R4904:Trim33 UTSW 3 103331647 missense possibly damaging 0.46
R5168:Trim33 UTSW 3 103341681 nonsense probably null
R5458:Trim33 UTSW 3 103330180 missense possibly damaging 0.64
R5910:Trim33 UTSW 3 103344576 missense probably damaging 1.00
R6195:Trim33 UTSW 3 103337532 critical splice donor site probably null
R6331:Trim33 UTSW 3 103341609 missense probably benign 0.00
R6636:Trim33 UTSW 3 103353719 missense probably damaging 1.00
R6642:Trim33 UTSW 3 103337514 missense probably damaging 0.99
R6783:Trim33 UTSW 3 103352087 missense probably damaging 1.00
R6856:Trim33 UTSW 3 103352049 missense probably damaging 0.97
R7220:Trim33 UTSW 3 103326793 missense possibly damaging 0.92
R7325:Trim33 UTSW 3 103321636 missense possibly damaging 0.93
R7374:Trim33 UTSW 3 103310323 missense probably damaging 0.98
R7430:Trim33 UTSW 3 103310903 missense possibly damaging 0.92
R7438:Trim33 UTSW 3 103346640 splice site probably benign
R7491:Trim33 UTSW 3 103326148 missense probably benign 0.28
R8001:Trim33 UTSW 3 103311515 critical splice donor site probably null
R8127:Trim33 UTSW 3 103331727 missense possibly damaging 0.66
RF005:Trim33 UTSW 3 103280212 frame shift probably null
RF007:Trim33 UTSW 3 103280217 small deletion probably benign
RF014:Trim33 UTSW 3 103329092 missense possibly damaging 0.94
RF061:Trim33 UTSW 3 103280217 small deletion probably benign
RF064:Trim33 UTSW 3 103280195 frame shift probably null
Z1176:Trim33 UTSW 3 103353727 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCAGGGAAATAACTCAAACTGCTTTGT -3'
(R):5'- AAACCAACTGCACTTGCATTATCTTCAC -3'

Sequencing Primer
(F):5'- AACTCAAACTGCTTTGTTCATGTC -3'
(R):5'- TCTTAGGGTGTGGAAGAGTAATC -3'
Posted On2013-07-11