Incidental Mutation 'R7158:Wdr62'
ID557435
Institutional Source Beutler Lab
Gene Symbol Wdr62
Ensembl Gene ENSMUSG00000037020
Gene NameWD repeat domain 62
Synonyms2310038K02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7158 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location30240138-30280419 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30270738 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 215 (V215I)
Ref Sequence ENSEMBL: ENSMUSP00000103825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108190] [ENSMUST00000145027]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108190
AA Change: V215I

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103825
Gene: ENSMUSG00000037020
AA Change: V215I

DomainStartEndE-ValueType
low complexity region 27 53 N/A INTRINSIC
WD40 101 142 4.24e-3 SMART
WD40 145 186 1.03e-1 SMART
WD40 189 226 7.4e0 SMART
WD40 284 322 3.55e1 SMART
WD40 353 388 1.85e0 SMART
WD40 395 442 2.98e-1 SMART
WD40 482 521 2.77e-1 SMART
WD40 524 566 2.3e0 SMART
WD40 570 610 4.18e-2 SMART
WD40 615 657 1.54e0 SMART
WD40 660 702 8.49e-3 SMART
WD40 705 744 3.61e-6 SMART
low complexity region 763 768 N/A INTRINSIC
low complexity region 797 811 N/A INTRINSIC
low complexity region 980 987 N/A INTRINSIC
low complexity region 1215 1226 N/A INTRINSIC
low complexity region 1302 1313 N/A INTRINSIC
low complexity region 1477 1497 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000145027
AA Change: V215I

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116772
Gene: ENSMUSG00000037020
AA Change: V215I

DomainStartEndE-ValueType
low complexity region 27 53 N/A INTRINSIC
WD40 101 142 4.24e-3 SMART
WD40 145 186 1.03e-1 SMART
WD40 189 226 7.4e0 SMART
WD40 284 322 3.55e1 SMART
WD40 353 388 1.85e0 SMART
WD40 395 442 2.98e-1 SMART
WD40 482 521 2.77e-1 SMART
WD40 524 566 2.3e0 SMART
WD40 570 610 4.18e-2 SMART
WD40 615 657 1.54e0 SMART
WD40 660 702 8.49e-3 SMART
WD40 705 744 3.61e-6 SMART
low complexity region 763 768 N/A INTRINSIC
low complexity region 797 811 N/A INTRINSIC
low complexity region 980 987 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is proposed to play a role in cerebral cortical development. Mutations in this gene have been associated with microencephaly, cortical malformations, and mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice for a hypomorphic allele exhibit reduced brain size due to decreased neural progenitor cells. Cells show spindle instability, spindle assembly checkpoint activation, mitotic arrest and cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,273,982 M454L probably benign Het
Abca8b T A 11: 109,934,589 E1595V probably damaging Het
Actr5 T A 2: 158,626,414 C155S possibly damaging Het
Acvr1b T A 15: 101,194,058 V73E probably benign Het
Add2 T C 6: 86,085,952 Y31H probably damaging Het
Akap13 G T 7: 75,579,594 V92F probably damaging Het
Alox8 T A 11: 69,185,870 M568L probably benign Het
Birc6 A T 17: 74,594,376 E1145V probably benign Het
Cacng1 A T 11: 107,703,839 M166K probably damaging Het
Ces1f A G 8: 93,268,016 F256L probably benign Het
Clpb A G 7: 101,663,832 R8G probably benign Het
Col6a5 A G 9: 105,864,208 V2504A possibly damaging Het
Coq8a T C 1: 180,179,184 D93G probably benign Het
Cry2 A T 2: 92,413,715 I371N probably damaging Het
Ddx43 A C 9: 78,412,219 Q276H probably damaging Het
Dock10 T C 1: 80,586,872 probably null Het
Dst A G 1: 34,274,285 T4378A probably benign Het
Fezf1 T C 6: 23,245,790 T459A probably benign Het
Gm10097 C T 10: 5,069,407 A72V unknown Het
Hydin A G 8: 110,609,671 S5027G possibly damaging Het
Inhbb A T 1: 119,421,022 L22* probably null Het
Kat8 G A 7: 127,922,159 G228S probably benign Het
Kif15 T A 9: 122,999,314 S897T probably benign Het
Kndc1 A G 7: 139,931,860 Y1460C possibly damaging Het
Krt78 T A 15: 101,951,806 D225V probably benign Het
Lama3 A T 18: 12,456,812 I800F probably benign Het
Mdn1 C A 4: 32,725,121 T2580K probably benign Het
Mest T C 6: 30,744,914 F201S possibly damaging Het
Mtmr9 A G 14: 63,526,869 F470L probably benign Het
Nfic C T 10: 81,420,605 R75Q probably damaging Het
Nme2 G A 11: 93,955,658 probably benign Het
Nrg4 A G 9: 55,242,100 L71P probably damaging Het
Pacsin2 C T 15: 83,379,742 E365K possibly damaging Het
Pappa T C 4: 65,204,867 I813T possibly damaging Het
Pcdhgb4 A G 18: 37,720,885 E111G probably damaging Het
Pdzd8 C T 19: 59,300,157 R937H probably damaging Het
Per1 T G 11: 69,104,104 probably benign Het
Pex2 A G 3: 5,561,336 F138L probably benign Het
Pold1 A T 7: 44,538,866 N529K probably damaging Het
Pou6f2 T C 13: 18,152,038 I316V Het
Prom1 A C 5: 44,012,913 I682S probably damaging Het
Prpf40a T C 2: 53,152,553 K481E probably damaging Het
Prrg4 A T 2: 104,832,613 V216E probably damaging Het
Ptch2 C T 4: 117,114,784 P1168S possibly damaging Het
Pvr C A 7: 19,918,637 E118* probably null Het
R3hcc1l C T 19: 42,583,429 P716S probably damaging Het
Rasa4 A G 5: 136,102,021 E382G probably damaging Het
Rbp3 T A 14: 33,955,556 M487K probably benign Het
Rsad2 A T 12: 26,450,780 probably null Het
Shmt1 T C 11: 60,790,242 I353V probably benign Het
Shprh C T 10: 11,166,730 T819I probably damaging Het
Skap1 T A 11: 96,526,057 F56Y possibly damaging Het
Slc22a16 G T 10: 40,573,741 V79L possibly damaging Het
Slc34a1 A G 13: 55,401,231 T165A probably damaging Het
Smchd1 A C 17: 71,400,150 I941R probably damaging Het
Syne1 C A 10: 5,057,931 V98F probably damaging Het
Tcaim A G 9: 122,818,990 D190G possibly damaging Het
Tdrd9 G C 12: 112,036,366 E816D probably benign Het
Tmem132d T C 5: 128,137,019 K326E possibly damaging Het
Uhrf1bp1 T A 17: 27,886,433 C644* probably null Het
Usp35 T C 7: 97,325,964 M1V probably null Het
Zan T C 5: 137,400,644 T4153A unknown Het
Zfp239 G T 6: 117,871,729 E143* probably null Het
Zfp292 T C 4: 34,808,679 D1460G probably benign Het
Zfp647 C T 15: 76,917,305 G90R probably benign Het
Other mutations in Wdr62
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Wdr62 APN 7 30243523 missense probably benign 0.00
IGL00428:Wdr62 APN 7 30270752 missense probably damaging 0.99
IGL00579:Wdr62 APN 7 30267895 missense probably damaging 1.00
IGL00709:Wdr62 APN 7 30242061 missense probably benign 0.05
IGL00924:Wdr62 APN 7 30265218 missense probably damaging 0.99
IGL00924:Wdr62 APN 7 30242806 missense probably damaging 1.00
IGL00956:Wdr62 APN 7 30261339 missense probably damaging 0.96
IGL01016:Wdr62 APN 7 30254251 missense probably benign 0.39
IGL01118:Wdr62 APN 7 30242781 missense probably damaging 0.96
IGL01458:Wdr62 APN 7 30241762 missense probably benign 0.08
IGL01977:Wdr62 APN 7 30258101 missense probably damaging 1.00
IGL02065:Wdr62 APN 7 30243469 missense possibly damaging 0.59
IGL02155:Wdr62 APN 7 30262643 missense probably damaging 1.00
IGL02260:Wdr62 APN 7 30270782 missense probably damaging 1.00
IGL02404:Wdr62 APN 7 30267873 missense probably damaging 1.00
IGL02491:Wdr62 APN 7 30242759 missense probably benign 0.19
IGL02556:Wdr62 APN 7 30245284 splice site probably null
IGL02739:Wdr62 APN 7 30242460 nonsense probably null
IGL03387:Wdr62 APN 7 30270774 missense possibly damaging 0.90
I0000:Wdr62 UTSW 7 30245327 missense probably benign 0.03
R0304:Wdr62 UTSW 7 30242874 missense probably benign 0.20
R0371:Wdr62 UTSW 7 30242158 missense possibly damaging 0.56
R0400:Wdr62 UTSW 7 30241462 missense possibly damaging 0.81
R0621:Wdr62 UTSW 7 30254061 missense possibly damaging 0.94
R0634:Wdr62 UTSW 7 30270174 missense probably damaging 0.98
R1758:Wdr62 UTSW 7 30267903 missense probably damaging 1.00
R2205:Wdr62 UTSW 7 30258149 critical splice acceptor site probably null
R2254:Wdr62 UTSW 7 30267903 missense probably damaging 0.97
R2255:Wdr62 UTSW 7 30267903 missense probably damaging 0.97
R2566:Wdr62 UTSW 7 30273999 missense probably damaging 1.00
R2851:Wdr62 UTSW 7 30261437 missense possibly damaging 0.70
R3150:Wdr62 UTSW 7 30271670 missense possibly damaging 0.94
R4355:Wdr62 UTSW 7 30242248 missense probably damaging 1.00
R4517:Wdr62 UTSW 7 30270258 missense probably damaging 1.00
R4839:Wdr62 UTSW 7 30241465 missense probably benign 0.00
R4839:Wdr62 UTSW 7 30270686 missense probably damaging 1.00
R5193:Wdr62 UTSW 7 30265167 missense probably damaging 0.99
R5289:Wdr62 UTSW 7 30267875 missense probably damaging 1.00
R5306:Wdr62 UTSW 7 30265263 missense possibly damaging 0.94
R5878:Wdr62 UTSW 7 30241347 missense probably benign
R5942:Wdr62 UTSW 7 30243079 nonsense probably null
R6051:Wdr62 UTSW 7 30261384 missense possibly damaging 0.69
R6237:Wdr62 UTSW 7 30242435 missense probably damaging 1.00
R6727:Wdr62 UTSW 7 30271620 missense probably damaging 1.00
R7208:Wdr62 UTSW 7 30252336 missense probably damaging 0.97
R7237:Wdr62 UTSW 7 30270444 splice site probably null
R7336:Wdr62 UTSW 7 30243917 missense probably damaging 0.98
R7559:Wdr62 UTSW 7 30270773 missense probably damaging 0.98
R7845:Wdr62 UTSW 7 30265242 missense possibly damaging 0.79
R7936:Wdr62 UTSW 7 30265159 missense probably damaging 1.00
R8002:Wdr62 UTSW 7 30252360 missense probably damaging 1.00
R8347:Wdr62 UTSW 7 30262703 missense possibly damaging 0.88
R8399:Wdr62 UTSW 7 30258061 missense probably damaging 1.00
Z1176:Wdr62 UTSW 7 30255928 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTTATGCCCAAGAAGCTGGG -3'
(R):5'- TGGAGCCTAGGAATGACCAG -3'

Sequencing Primer
(F):5'- GACCTGACCATAATGGGT -3'
(R):5'- CTTAGAGTTTAGACCACTGCCAGG -3'
Posted On2019-06-26