Incidental Mutation 'R7158:Pold1'
ID557436
Institutional Source Beutler Lab
Gene Symbol Pold1
Ensembl Gene ENSMUSG00000038644
Gene Namepolymerase (DNA directed), delta 1, catalytic subunit
Synonyms125kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R7158 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location44532746-44548849 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44538866 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 529 (N529K)
Ref Sequence ENSEMBL: ENSMUSP00000039776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049343] [ENSMUST00000145956] [ENSMUST00000151793]
Predicted Effect probably damaging
Transcript: ENSMUST00000049343
AA Change: N529K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039776
Gene: ENSMUSG00000038644
AA Change: N529K

DomainStartEndE-ValueType
coiled coil region 34 58 N/A INTRINSIC
Blast:POLBc 65 108 1e-7 BLAST
low complexity region 212 225 N/A INTRINSIC
Blast:POLBc 227 279 1e-19 BLAST
POLBc 306 763 2.53e-161 SMART
Blast:POLBc 790 837 1e-18 BLAST
Pfam:zf-C4pol 1010 1080 5.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145956
SMART Domains Protein: ENSMUSP00000117844
Gene: ENSMUSG00000038644

DomainStartEndE-ValueType
coiled coil region 34 58 N/A INTRINSIC
Blast:POLBc 65 108 2e-8 BLAST
PDB:3IAY|A 76 151 7e-8 PDB
SCOP:d1tgoa1 117 153 3e-10 SMART
Blast:POLBc 130 153 7e-7 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000151793
AA Change: N529K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117157
Gene: ENSMUSG00000038644
AA Change: N529K

DomainStartEndE-ValueType
coiled coil region 34 58 N/A INTRINSIC
Blast:POLBc 66 108 1e-7 BLAST
low complexity region 212 225 N/A INTRINSIC
Blast:POLBc 227 279 1e-19 BLAST
POLBc 306 763 7.8e-164 SMART
Blast:POLBc 790 837 1e-18 BLAST
low complexity region 914 938 N/A INTRINSIC
low complexity region 959 980 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 125-kDa catalytic subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 6. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene have an elevated mutation rate as well as an increased incidence of tumors. Median age for these mice is around 10 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,273,982 M454L probably benign Het
Abca8b T A 11: 109,934,589 E1595V probably damaging Het
Actr5 T A 2: 158,626,414 C155S possibly damaging Het
Acvr1b T A 15: 101,194,058 V73E probably benign Het
Add2 T C 6: 86,085,952 Y31H probably damaging Het
Akap13 G T 7: 75,579,594 V92F probably damaging Het
Alox8 T A 11: 69,185,870 M568L probably benign Het
Birc6 A T 17: 74,594,376 E1145V probably benign Het
Cacng1 A T 11: 107,703,839 M166K probably damaging Het
Ces1f A G 8: 93,268,016 F256L probably benign Het
Clpb A G 7: 101,663,832 R8G probably benign Het
Col6a5 A G 9: 105,864,208 V2504A possibly damaging Het
Coq8a T C 1: 180,179,184 D93G probably benign Het
Cry2 A T 2: 92,413,715 I371N probably damaging Het
Ddx43 A C 9: 78,412,219 Q276H probably damaging Het
Dock10 T C 1: 80,586,872 probably null Het
Dst A G 1: 34,274,285 T4378A probably benign Het
Fezf1 T C 6: 23,245,790 T459A probably benign Het
Gm10097 C T 10: 5,069,407 A72V unknown Het
Hydin A G 8: 110,609,671 S5027G possibly damaging Het
Inhbb A T 1: 119,421,022 L22* probably null Het
Kat8 G A 7: 127,922,159 G228S probably benign Het
Kif15 T A 9: 122,999,314 S897T probably benign Het
Kndc1 A G 7: 139,931,860 Y1460C possibly damaging Het
Krt78 T A 15: 101,951,806 D225V probably benign Het
Lama3 A T 18: 12,456,812 I800F probably benign Het
Mdn1 C A 4: 32,725,121 T2580K probably benign Het
Mest T C 6: 30,744,914 F201S possibly damaging Het
Mtmr9 A G 14: 63,526,869 F470L probably benign Het
Nfic C T 10: 81,420,605 R75Q probably damaging Het
Nme2 G A 11: 93,955,658 probably benign Het
Nrg4 A G 9: 55,242,100 L71P probably damaging Het
Pacsin2 C T 15: 83,379,742 E365K possibly damaging Het
Pappa T C 4: 65,204,867 I813T possibly damaging Het
Pcdhgb4 A G 18: 37,720,885 E111G probably damaging Het
Pdzd8 C T 19: 59,300,157 R937H probably damaging Het
Per1 T G 11: 69,104,104 probably benign Het
Pex2 A G 3: 5,561,336 F138L probably benign Het
Pou6f2 T C 13: 18,152,038 I316V Het
Prom1 A C 5: 44,012,913 I682S probably damaging Het
Prpf40a T C 2: 53,152,553 K481E probably damaging Het
Prrg4 A T 2: 104,832,613 V216E probably damaging Het
Ptch2 C T 4: 117,114,784 P1168S possibly damaging Het
Pvr C A 7: 19,918,637 E118* probably null Het
R3hcc1l C T 19: 42,583,429 P716S probably damaging Het
Rasa4 A G 5: 136,102,021 E382G probably damaging Het
Rbp3 T A 14: 33,955,556 M487K probably benign Het
Rsad2 A T 12: 26,450,780 probably null Het
Shmt1 T C 11: 60,790,242 I353V probably benign Het
Shprh C T 10: 11,166,730 T819I probably damaging Het
Skap1 T A 11: 96,526,057 F56Y possibly damaging Het
Slc22a16 G T 10: 40,573,741 V79L possibly damaging Het
Slc34a1 A G 13: 55,401,231 T165A probably damaging Het
Smchd1 A C 17: 71,400,150 I941R probably damaging Het
Syne1 C A 10: 5,057,931 V98F probably damaging Het
Tcaim A G 9: 122,818,990 D190G possibly damaging Het
Tdrd9 G C 12: 112,036,366 E816D probably benign Het
Tmem132d T C 5: 128,137,019 K326E possibly damaging Het
Uhrf1bp1 T A 17: 27,886,433 C644* probably null Het
Usp35 T C 7: 97,325,964 M1V probably null Het
Wdr62 C T 7: 30,270,738 V215I possibly damaging Het
Zan T C 5: 137,400,644 T4153A unknown Het
Zfp239 G T 6: 117,871,729 E143* probably null Het
Zfp292 T C 4: 34,808,679 D1460G probably benign Het
Zfp647 C T 15: 76,917,305 G90R probably benign Het
Other mutations in Pold1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Pold1 APN 7 44543232 splice site probably benign
IGL01626:Pold1 APN 7 44533372 critical splice donor site probably null
IGL01635:Pold1 APN 7 44535977 missense probably damaging 1.00
IGL02165:Pold1 APN 7 44538060 missense probably damaging 1.00
IGL02197:Pold1 APN 7 44542239 missense probably benign 0.07
IGL02579:Pold1 APN 7 44543279 missense probably damaging 1.00
IGL03104:Pold1 APN 7 44540580 missense probably damaging 1.00
IGL03118:Pold1 APN 7 44539400 missense probably benign 0.17
PIT4243001:Pold1 UTSW 7 44542158 missense possibly damaging 0.77
PIT4431001:Pold1 UTSW 7 44538894 missense probably damaging 1.00
R0184:Pold1 UTSW 7 44541715 missense probably benign 0.32
R0266:Pold1 UTSW 7 44541025 splice site probably benign
R0537:Pold1 UTSW 7 44535092 missense probably damaging 1.00
R1251:Pold1 UTSW 7 44535051 missense probably benign 0.02
R1348:Pold1 UTSW 7 44534682 missense probably benign 0.00
R1376:Pold1 UTSW 7 44540562 missense probably damaging 1.00
R1376:Pold1 UTSW 7 44540562 missense probably damaging 1.00
R1445:Pold1 UTSW 7 44542757 splice site probably benign
R2156:Pold1 UTSW 7 44539118 missense probably damaging 1.00
R2256:Pold1 UTSW 7 44533799 critical splice acceptor site probably null
R2259:Pold1 UTSW 7 44541484 splice site probably benign
R2870:Pold1 UTSW 7 44543347 synonymous silent
R3793:Pold1 UTSW 7 44541570 missense probably damaging 1.00
R4493:Pold1 UTSW 7 44537708 missense probably damaging 1.00
R4583:Pold1 UTSW 7 44538913 missense probably damaging 0.97
R4661:Pold1 UTSW 7 44532809 missense probably damaging 0.99
R4738:Pold1 UTSW 7 44541329 missense probably damaging 0.99
R4769:Pold1 UTSW 7 44535071 missense probably damaging 1.00
R4797:Pold1 UTSW 7 44541901 missense possibly damaging 0.91
R5009:Pold1 UTSW 7 44533902 missense probably benign 0.13
R5150:Pold1 UTSW 7 44535832 missense possibly damaging 0.91
R5534:Pold1 UTSW 7 44538619 missense probably damaging 1.00
R5988:Pold1 UTSW 7 44540580 missense probably damaging 1.00
R6113:Pold1 UTSW 7 44537700 missense probably damaging 1.00
R6127:Pold1 UTSW 7 44542121 missense probably damaging 1.00
R6232:Pold1 UTSW 7 44540842 critical splice donor site probably null
R6435:Pold1 UTSW 7 44538778 missense probably damaging 1.00
R6436:Pold1 UTSW 7 44538778 missense probably damaging 1.00
R6437:Pold1 UTSW 7 44538778 missense probably damaging 1.00
R6930:Pold1 UTSW 7 44542206 missense probably benign
R7049:Pold1 UTSW 7 44541371 missense possibly damaging 0.95
R7170:Pold1 UTSW 7 44542148 missense possibly damaging 0.93
R7235:Pold1 UTSW 7 44541820 missense probably benign 0.00
R7372:Pold1 UTSW 7 44543423 missense possibly damaging 0.59
R7511:Pold1 UTSW 7 44542190 missense possibly damaging 0.67
R7797:Pold1 UTSW 7 44541789 missense probably benign 0.00
Z1176:Pold1 UTSW 7 44541780 missense probably benign 0.15
Z1176:Pold1 UTSW 7 44542232 missense probably benign
Z1177:Pold1 UTSW 7 44541958 missense not run
Predicted Primers PCR Primer
(F):5'- TCTTCACCACAGGCATCAG -3'
(R):5'- ACGTTCAGCACAGCATCATC -3'

Sequencing Primer
(F):5'- CGCATGGCCTGGAGAAAG -3'
(R):5'- TCATCACCGACCTGCAGG -3'
Posted On2019-06-26