Incidental Mutation 'R7158:Kndc1'
ID 557441
Institutional Source Beutler Lab
Gene Symbol Kndc1
Ensembl Gene ENSMUSG00000066129
Gene Name kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms B830014K08Rik, 2410012C07Rik, very-kind, VKIND
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7158 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 139894696-139941537 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 139931860 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1460 (Y1460C)
Ref Sequence ENSEMBL: ENSMUSP00000050586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053445]
AlphaFold Q0KK55
Predicted Effect possibly damaging
Transcript: ENSMUST00000053445
AA Change: Y1460C

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129
AA Change: Y1460C

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
coiled coil region 1121 1151 N/A INTRINSIC
Pfam:RasGEF_N 1242 1341 2.2e-17 PFAM
Pfam:RasGEF 1464 1672 3.8e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,273,982 M454L probably benign Het
Abca8b T A 11: 109,934,589 E1595V probably damaging Het
Actr5 T A 2: 158,626,414 C155S possibly damaging Het
Acvr1b T A 15: 101,194,058 V73E probably benign Het
Add2 T C 6: 86,085,952 Y31H probably damaging Het
Akap13 G T 7: 75,579,594 V92F probably damaging Het
Alox8 T A 11: 69,185,870 M568L probably benign Het
Birc6 A T 17: 74,594,376 E1145V probably benign Het
Cacng1 A T 11: 107,703,839 M166K probably damaging Het
Ces1f A G 8: 93,268,016 F256L probably benign Het
Clpb A G 7: 101,663,832 R8G probably benign Het
Col6a5 A G 9: 105,864,208 V2504A possibly damaging Het
Coq8a T C 1: 180,179,184 D93G probably benign Het
Cry2 A T 2: 92,413,715 I371N probably damaging Het
Ddx43 A C 9: 78,412,219 Q276H probably damaging Het
Dock10 T C 1: 80,586,872 probably null Het
Dst A G 1: 34,274,285 T4378A probably benign Het
Fezf1 T C 6: 23,245,790 T459A probably benign Het
Gm10097 C T 10: 5,069,407 A72V unknown Het
Hydin A G 8: 110,609,671 S5027G possibly damaging Het
Inhbb A T 1: 119,421,022 L22* probably null Het
Kat8 G A 7: 127,922,159 G228S probably benign Het
Kif15 T A 9: 122,999,314 S897T probably benign Het
Krt78 T A 15: 101,951,806 D225V probably benign Het
Lama3 A T 18: 12,456,812 I800F probably benign Het
Mdn1 C A 4: 32,725,121 T2580K probably benign Het
Mest T C 6: 30,744,914 F201S possibly damaging Het
Mtmr9 A G 14: 63,526,869 F470L probably benign Het
Nfic C T 10: 81,420,605 R75Q probably damaging Het
Nme2 G A 11: 93,955,658 probably benign Het
Nrg4 A G 9: 55,242,100 L71P probably damaging Het
Pacsin2 C T 15: 83,379,742 E365K possibly damaging Het
Pappa T C 4: 65,204,867 I813T possibly damaging Het
Pcdhgb4 A G 18: 37,720,885 E111G probably damaging Het
Pdzd8 C T 19: 59,300,157 R937H probably damaging Het
Per1 T G 11: 69,104,104 probably benign Het
Pex2 A G 3: 5,561,336 F138L probably benign Het
Pold1 A T 7: 44,538,866 N529K probably damaging Het
Pou6f2 T C 13: 18,152,038 I316V Het
Prom1 A C 5: 44,012,913 I682S probably damaging Het
Prpf40a T C 2: 53,152,553 K481E probably damaging Het
Prrg4 A T 2: 104,832,613 V216E probably damaging Het
Ptch2 C T 4: 117,114,784 P1168S possibly damaging Het
Pvr C A 7: 19,918,637 E118* probably null Het
R3hcc1l C T 19: 42,583,429 P716S probably damaging Het
Rasa4 A G 5: 136,102,021 E382G probably damaging Het
Rbp3 T A 14: 33,955,556 M487K probably benign Het
Rsad2 A T 12: 26,450,780 probably null Het
Shmt1 T C 11: 60,790,242 I353V probably benign Het
Shprh C T 10: 11,166,730 T819I probably damaging Het
Skap1 T A 11: 96,526,057 F56Y possibly damaging Het
Slc22a16 G T 10: 40,573,741 V79L possibly damaging Het
Slc34a1 A G 13: 55,401,231 T165A probably damaging Het
Smchd1 A C 17: 71,400,150 I941R probably damaging Het
Syne1 C A 10: 5,057,931 V98F probably damaging Het
Tcaim A G 9: 122,818,990 D190G possibly damaging Het
Tdrd9 G C 12: 112,036,366 E816D probably benign Het
Tmem132d T C 5: 128,137,019 K326E possibly damaging Het
Uhrf1bp1 T A 17: 27,886,433 C644* probably null Het
Usp35 T C 7: 97,325,964 M1V probably null Het
Wdr62 C T 7: 30,270,738 V215I possibly damaging Het
Zan T C 5: 137,400,644 T4153A unknown Het
Zfp239 G T 6: 117,871,729 E143* probably null Het
Zfp292 T C 4: 34,808,679 D1460G probably benign Het
Zfp647 C T 15: 76,917,305 G90R probably benign Het
Other mutations in Kndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Kndc1 APN 7 139901988 splice site probably benign
IGL01061:Kndc1 APN 7 139922694 missense probably benign 0.00
IGL01099:Kndc1 APN 7 139920784 missense probably damaging 1.00
IGL01522:Kndc1 APN 7 139913972 splice site probably benign
IGL01767:Kndc1 APN 7 139930046 missense probably damaging 1.00
IGL01884:Kndc1 APN 7 139914194 missense probably damaging 1.00
IGL01932:Kndc1 APN 7 139923790 missense probably damaging 0.98
IGL02133:Kndc1 APN 7 139920767 missense probably benign 0.19
IGL02411:Kndc1 APN 7 139921913 critical splice donor site probably null
IGL02472:Kndc1 APN 7 139910901 missense probably benign 0.01
IGL02537:Kndc1 APN 7 139910410 missense probably benign 0.01
IGL02708:Kndc1 APN 7 139901181 missense probably damaging 1.00
IGL03115:Kndc1 APN 7 139921509 missense probably benign 0.28
IGL03160:Kndc1 APN 7 139920689 nonsense probably null
IGL03138:Kndc1 UTSW 7 139939878 missense possibly damaging 0.89
PIT4142001:Kndc1 UTSW 7 139923776 frame shift probably null
PIT4696001:Kndc1 UTSW 7 139932917 missense probably damaging 1.00
R0349:Kndc1 UTSW 7 139910304 missense probably benign 0.00
R0384:Kndc1 UTSW 7 139910599 missense possibly damaging 0.85
R0415:Kndc1 UTSW 7 139930124 missense probably damaging 1.00
R0421:Kndc1 UTSW 7 139908996 missense probably damaging 1.00
R0487:Kndc1 UTSW 7 139914023 missense probably null 0.19
R0530:Kndc1 UTSW 7 139901237 missense probably damaging 1.00
R0905:Kndc1 UTSW 7 139923735 missense possibly damaging 0.94
R1434:Kndc1 UTSW 7 139922684 missense probably damaging 1.00
R1608:Kndc1 UTSW 7 139927408 missense possibly damaging 0.80
R1644:Kndc1 UTSW 7 139930756 missense probably damaging 1.00
R1835:Kndc1 UTSW 7 139927711 missense probably damaging 0.99
R2012:Kndc1 UTSW 7 139921280 missense possibly damaging 0.90
R2102:Kndc1 UTSW 7 139930761 missense probably benign 0.02
R2103:Kndc1 UTSW 7 139921234 missense probably benign 0.01
R2128:Kndc1 UTSW 7 139930112 missense probably damaging 1.00
R2516:Kndc1 UTSW 7 139921822 missense probably damaging 1.00
R3030:Kndc1 UTSW 7 139901207 missense probably damaging 1.00
R3617:Kndc1 UTSW 7 139902060 splice site probably benign
R3747:Kndc1 UTSW 7 139927904 critical splice donor site probably null
R3848:Kndc1 UTSW 7 139908977 missense probably damaging 1.00
R4028:Kndc1 UTSW 7 139930028 missense probably damaging 0.98
R4043:Kndc1 UTSW 7 139924129 missense probably benign 0.06
R4044:Kndc1 UTSW 7 139924129 missense probably benign 0.06
R4095:Kndc1 UTSW 7 139937025 missense possibly damaging 0.49
R4289:Kndc1 UTSW 7 139910882 missense probably benign 0.01
R4478:Kndc1 UTSW 7 139920684 missense probably damaging 1.00
R4514:Kndc1 UTSW 7 139910286 missense probably benign 0.00
R4540:Kndc1 UTSW 7 139921427 nonsense probably null
R4584:Kndc1 UTSW 7 139901243 missense probably damaging 1.00
R4693:Kndc1 UTSW 7 139921779 missense probably benign 0.02
R4705:Kndc1 UTSW 7 139930123 missense possibly damaging 0.81
R4773:Kndc1 UTSW 7 139924031 nonsense probably null
R4859:Kndc1 UTSW 7 139921905 missense probably benign 0.03
R5004:Kndc1 UTSW 7 139932879 nonsense probably null
R5037:Kndc1 UTSW 7 139910455 missense possibly damaging 0.52
R5322:Kndc1 UTSW 7 139936809 missense probably damaging 1.00
R5428:Kndc1 UTSW 7 139908962 missense probably damaging 0.99
R5503:Kndc1 UTSW 7 139931889 missense probably damaging 1.00
R5506:Kndc1 UTSW 7 139927891 missense probably damaging 1.00
R5525:Kndc1 UTSW 7 139924111 missense probably benign 0.00
R5888:Kndc1 UTSW 7 139895217 missense probably benign 0.00
R5942:Kndc1 UTSW 7 139936879 missense probably damaging 1.00
R5979:Kndc1 UTSW 7 139939827 missense probably benign 0.05
R5990:Kndc1 UTSW 7 139927420 missense probably damaging 0.99
R6038:Kndc1 UTSW 7 139923775 frame shift probably null
R6076:Kndc1 UTSW 7 139902038 missense probably damaging 1.00
R6118:Kndc1 UTSW 7 139923802 missense probably damaging 1.00
R6151:Kndc1 UTSW 7 139921213 missense probably benign 0.04
R6276:Kndc1 UTSW 7 139921063 missense probably benign
R6367:Kndc1 UTSW 7 139913506 missense probably damaging 1.00
R6726:Kndc1 UTSW 7 139922751 critical splice donor site probably null
R6745:Kndc1 UTSW 7 139920976 missense probably benign 0.02
R6886:Kndc1 UTSW 7 139913569 missense probably benign 0.01
R6912:Kndc1 UTSW 7 139910278 missense probably damaging 0.99
R7070:Kndc1 UTSW 7 139921828 missense probably damaging 1.00
R7123:Kndc1 UTSW 7 139936836 missense probably damaging 0.99
R7248:Kndc1 UTSW 7 139920783 missense probably damaging 1.00
R7437:Kndc1 UTSW 7 139909043 missense probably damaging 1.00
R7564:Kndc1 UTSW 7 139920696 missense probably benign 0.01
R7570:Kndc1 UTSW 7 139923775 frame shift probably null
R7625:Kndc1 UTSW 7 139938017 missense possibly damaging 0.90
R7629:Kndc1 UTSW 7 139895260 missense probably damaging 1.00
R7726:Kndc1 UTSW 7 139939838 missense possibly damaging 0.67
R7840:Kndc1 UTSW 7 139923816 missense probably damaging 1.00
R7859:Kndc1 UTSW 7 139920964 missense possibly damaging 0.57
R7934:Kndc1 UTSW 7 139921486 missense probably benign 0.02
R8011:Kndc1 UTSW 7 139910620 missense possibly damaging 0.90
R8062:Kndc1 UTSW 7 139918844 missense probably benign 0.01
R8134:Kndc1 UTSW 7 139901369 splice site probably null
R8197:Kndc1 UTSW 7 139913531 missense probably damaging 1.00
R8350:Kndc1 UTSW 7 139924045 missense probably damaging 1.00
R8399:Kndc1 UTSW 7 139913518 missense probably damaging 1.00
R8400:Kndc1 UTSW 7 139913518 missense probably damaging 1.00
R8447:Kndc1 UTSW 7 139901205 missense probably damaging 1.00
R8534:Kndc1 UTSW 7 139923753 missense probably benign 0.27
R8735:Kndc1 UTSW 7 139910214 missense probably benign 0.00
R8816:Kndc1 UTSW 7 139937996 missense probably damaging 1.00
R8883:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R8899:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139924061 missense possibly damaging 0.95
R8961:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9002:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9010:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9065:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9066:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9223:Kndc1 UTSW 7 139921441 missense possibly damaging 0.89
R9230:Kndc1 UTSW 7 139920684 missense probably damaging 1.00
R9291:Kndc1 UTSW 7 139895224 missense possibly damaging 0.55
R9441:Kndc1 UTSW 7 139921476 missense probably damaging 0.99
R9476:Kndc1 UTSW 7 139930118 missense probably benign 0.00
R9510:Kndc1 UTSW 7 139930118 missense probably benign 0.00
R9518:Kndc1 UTSW 7 139939914 missense probably damaging 1.00
R9758:Kndc1 UTSW 7 139920704 missense possibly damaging 0.71
Z1177:Kndc1 UTSW 7 139921912 missense possibly damaging 0.63
Z1186:Kndc1 UTSW 7 139910813 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCAGAGCTTCTCTTGGAGAC -3'
(R):5'- GTCTCCCTGTTTTAAAGACAGAACG -3'

Sequencing Primer
(F):5'- TCTCTTGGAGACTGCCTCGG -3'
(R):5'- CCTGTTTTAAAGACAGAACGTGTGC -3'
Posted On 2019-06-26