Incidental Mutation 'R7158:Kndc1'
ID 557441
Institutional Source Beutler Lab
Gene Symbol Kndc1
Ensembl Gene ENSMUSG00000066129
Gene Name kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms B830014K08Rik, VKIND, very-kind, 2410012C07Rik
MMRRC Submission 045329-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7158 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 139474612-139521450 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 139511773 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1460 (Y1460C)
Ref Sequence ENSEMBL: ENSMUSP00000050586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053445]
AlphaFold Q0KK55
Predicted Effect possibly damaging
Transcript: ENSMUST00000053445
AA Change: Y1460C

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129
AA Change: Y1460C

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
coiled coil region 1121 1151 N/A INTRINSIC
Pfam:RasGEF_N 1242 1341 2.2e-17 PFAM
Pfam:RasGEF 1464 1672 3.8e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,223,982 (GRCm39) M454L probably benign Het
Abca8b T A 11: 109,825,415 (GRCm39) E1595V probably damaging Het
Actr5 T A 2: 158,468,334 (GRCm39) C155S possibly damaging Het
Acvr1b T A 15: 101,091,939 (GRCm39) V73E probably benign Het
Add2 T C 6: 86,062,934 (GRCm39) Y31H probably damaging Het
Akap13 G T 7: 75,229,342 (GRCm39) V92F probably damaging Het
Alox8 T A 11: 69,076,696 (GRCm39) M568L probably benign Het
Birc6 A T 17: 74,901,371 (GRCm39) E1145V probably benign Het
Bltp3a T A 17: 28,105,407 (GRCm39) C644* probably null Het
Cacng1 A T 11: 107,594,665 (GRCm39) M166K probably damaging Het
Ces1f A G 8: 93,994,644 (GRCm39) F256L probably benign Het
Clpb A G 7: 101,313,039 (GRCm39) R8G probably benign Het
Col6a5 A G 9: 105,741,407 (GRCm39) V2504A possibly damaging Het
Coq8a T C 1: 180,006,749 (GRCm39) D93G probably benign Het
Cry2 A T 2: 92,244,060 (GRCm39) I371N probably damaging Het
Ddx43 A C 9: 78,319,501 (GRCm39) Q276H probably damaging Het
Dock10 T C 1: 80,564,589 (GRCm39) probably null Het
Dst A G 1: 34,313,366 (GRCm39) T4378A probably benign Het
Fezf1 T C 6: 23,245,789 (GRCm39) T459A probably benign Het
Gm10097 C T 10: 5,019,407 (GRCm39) A72V unknown Het
Hydin A G 8: 111,336,303 (GRCm39) S5027G possibly damaging Het
Inhbb A T 1: 119,348,752 (GRCm39) L22* probably null Het
Kat8 G A 7: 127,521,331 (GRCm39) G228S probably benign Het
Kif15 T A 9: 122,828,379 (GRCm39) S897T probably benign Het
Krt78 T A 15: 101,860,241 (GRCm39) D225V probably benign Het
Lama3 A T 18: 12,589,869 (GRCm39) I800F probably benign Het
Mdn1 C A 4: 32,725,121 (GRCm39) T2580K probably benign Het
Mest T C 6: 30,744,913 (GRCm39) F201S possibly damaging Het
Mtmr9 A G 14: 63,764,318 (GRCm39) F470L probably benign Het
Nfic C T 10: 81,256,439 (GRCm39) R75Q probably damaging Het
Nme2 G A 11: 93,846,484 (GRCm39) probably benign Het
Nrg4 A G 9: 55,149,384 (GRCm39) L71P probably damaging Het
Pacsin2 C T 15: 83,263,943 (GRCm39) E365K possibly damaging Het
Pappa T C 4: 65,123,104 (GRCm39) I813T possibly damaging Het
Pcdhgb4 A G 18: 37,853,938 (GRCm39) E111G probably damaging Het
Pdzd8 C T 19: 59,288,589 (GRCm39) R937H probably damaging Het
Per1 T G 11: 68,994,930 (GRCm39) probably benign Het
Pex2 A G 3: 5,626,396 (GRCm39) F138L probably benign Het
Pold1 A T 7: 44,188,290 (GRCm39) N529K probably damaging Het
Pou6f2 T C 13: 18,326,623 (GRCm39) I316V Het
Prom1 A C 5: 44,170,255 (GRCm39) I682S probably damaging Het
Prpf40a T C 2: 53,042,565 (GRCm39) K481E probably damaging Het
Prrg4 A T 2: 104,662,958 (GRCm39) V216E probably damaging Het
Ptch2 C T 4: 116,971,981 (GRCm39) P1168S possibly damaging Het
Pvr C A 7: 19,652,562 (GRCm39) E118* probably null Het
R3hcc1l C T 19: 42,571,868 (GRCm39) P716S probably damaging Het
Rasa4 A G 5: 136,130,875 (GRCm39) E382G probably damaging Het
Rbp3 T A 14: 33,677,513 (GRCm39) M487K probably benign Het
Rsad2 A T 12: 26,500,779 (GRCm39) probably null Het
Shmt1 T C 11: 60,681,068 (GRCm39) I353V probably benign Het
Shprh C T 10: 11,042,474 (GRCm39) T819I probably damaging Het
Skap1 T A 11: 96,416,883 (GRCm39) F56Y possibly damaging Het
Slc22a16 G T 10: 40,449,737 (GRCm39) V79L possibly damaging Het
Slc34a1 A G 13: 55,549,044 (GRCm39) T165A probably damaging Het
Smchd1 A C 17: 71,707,145 (GRCm39) I941R probably damaging Het
Syne1 C A 10: 5,007,931 (GRCm39) V98F probably damaging Het
Tcaim A G 9: 122,648,055 (GRCm39) D190G possibly damaging Het
Tdrd9 G C 12: 112,002,800 (GRCm39) E816D probably benign Het
Tmem132d T C 5: 128,214,083 (GRCm39) K326E possibly damaging Het
Usp35 T C 7: 96,975,171 (GRCm39) M1V probably null Het
Wdr62 C T 7: 29,970,163 (GRCm39) V215I possibly damaging Het
Zan T C 5: 137,398,906 (GRCm39) T4153A unknown Het
Zfp239 G T 6: 117,848,690 (GRCm39) E143* probably null Het
Zfp292 T C 4: 34,808,679 (GRCm39) D1460G probably benign Het
Zfp647 C T 15: 76,801,505 (GRCm39) G90R probably benign Het
Other mutations in Kndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Kndc1 APN 7 139,481,904 (GRCm39) splice site probably benign
IGL01061:Kndc1 APN 7 139,502,610 (GRCm39) missense probably benign 0.00
IGL01099:Kndc1 APN 7 139,500,700 (GRCm39) missense probably damaging 1.00
IGL01522:Kndc1 APN 7 139,493,888 (GRCm39) splice site probably benign
IGL01767:Kndc1 APN 7 139,509,959 (GRCm39) missense probably damaging 1.00
IGL01884:Kndc1 APN 7 139,494,110 (GRCm39) missense probably damaging 1.00
IGL01932:Kndc1 APN 7 139,503,705 (GRCm39) missense probably damaging 0.98
IGL02133:Kndc1 APN 7 139,500,683 (GRCm39) missense probably benign 0.19
IGL02411:Kndc1 APN 7 139,501,829 (GRCm39) critical splice donor site probably null
IGL02472:Kndc1 APN 7 139,490,817 (GRCm39) missense probably benign 0.01
IGL02537:Kndc1 APN 7 139,490,326 (GRCm39) missense probably benign 0.01
IGL02708:Kndc1 APN 7 139,481,097 (GRCm39) missense probably damaging 1.00
IGL03115:Kndc1 APN 7 139,501,425 (GRCm39) missense probably benign 0.28
IGL03160:Kndc1 APN 7 139,500,605 (GRCm39) nonsense probably null
IGL03138:Kndc1 UTSW 7 139,519,791 (GRCm39) missense possibly damaging 0.89
PIT4142001:Kndc1 UTSW 7 139,503,692 (GRCm39) frame shift probably null
PIT4696001:Kndc1 UTSW 7 139,512,830 (GRCm39) missense probably damaging 1.00
R0349:Kndc1 UTSW 7 139,490,220 (GRCm39) missense probably benign 0.00
R0384:Kndc1 UTSW 7 139,490,515 (GRCm39) missense possibly damaging 0.85
R0415:Kndc1 UTSW 7 139,510,037 (GRCm39) missense probably damaging 1.00
R0421:Kndc1 UTSW 7 139,488,912 (GRCm39) missense probably damaging 1.00
R0487:Kndc1 UTSW 7 139,493,939 (GRCm39) missense probably null 0.19
R0530:Kndc1 UTSW 7 139,481,153 (GRCm39) missense probably damaging 1.00
R0905:Kndc1 UTSW 7 139,503,651 (GRCm39) missense possibly damaging 0.94
R1434:Kndc1 UTSW 7 139,502,600 (GRCm39) missense probably damaging 1.00
R1608:Kndc1 UTSW 7 139,507,321 (GRCm39) missense possibly damaging 0.80
R1644:Kndc1 UTSW 7 139,510,669 (GRCm39) missense probably damaging 1.00
R1835:Kndc1 UTSW 7 139,507,624 (GRCm39) missense probably damaging 0.99
R2012:Kndc1 UTSW 7 139,501,196 (GRCm39) missense possibly damaging 0.90
R2102:Kndc1 UTSW 7 139,510,674 (GRCm39) missense probably benign 0.02
R2103:Kndc1 UTSW 7 139,501,150 (GRCm39) missense probably benign 0.01
R2128:Kndc1 UTSW 7 139,510,025 (GRCm39) missense probably damaging 1.00
R2516:Kndc1 UTSW 7 139,501,738 (GRCm39) missense probably damaging 1.00
R3030:Kndc1 UTSW 7 139,481,123 (GRCm39) missense probably damaging 1.00
R3617:Kndc1 UTSW 7 139,481,976 (GRCm39) splice site probably benign
R3747:Kndc1 UTSW 7 139,507,817 (GRCm39) critical splice donor site probably null
R3848:Kndc1 UTSW 7 139,488,893 (GRCm39) missense probably damaging 1.00
R4028:Kndc1 UTSW 7 139,509,941 (GRCm39) missense probably damaging 0.98
R4043:Kndc1 UTSW 7 139,504,044 (GRCm39) missense probably benign 0.06
R4044:Kndc1 UTSW 7 139,504,044 (GRCm39) missense probably benign 0.06
R4095:Kndc1 UTSW 7 139,516,938 (GRCm39) missense possibly damaging 0.49
R4289:Kndc1 UTSW 7 139,490,798 (GRCm39) missense probably benign 0.01
R4478:Kndc1 UTSW 7 139,500,600 (GRCm39) missense probably damaging 1.00
R4514:Kndc1 UTSW 7 139,490,202 (GRCm39) missense probably benign 0.00
R4540:Kndc1 UTSW 7 139,501,343 (GRCm39) nonsense probably null
R4584:Kndc1 UTSW 7 139,481,159 (GRCm39) missense probably damaging 1.00
R4693:Kndc1 UTSW 7 139,501,695 (GRCm39) missense probably benign 0.02
R4705:Kndc1 UTSW 7 139,510,036 (GRCm39) missense possibly damaging 0.81
R4773:Kndc1 UTSW 7 139,503,946 (GRCm39) nonsense probably null
R4859:Kndc1 UTSW 7 139,501,821 (GRCm39) missense probably benign 0.03
R5004:Kndc1 UTSW 7 139,512,792 (GRCm39) nonsense probably null
R5037:Kndc1 UTSW 7 139,490,371 (GRCm39) missense possibly damaging 0.52
R5322:Kndc1 UTSW 7 139,516,722 (GRCm39) missense probably damaging 1.00
R5428:Kndc1 UTSW 7 139,488,878 (GRCm39) missense probably damaging 0.99
R5503:Kndc1 UTSW 7 139,511,802 (GRCm39) missense probably damaging 1.00
R5506:Kndc1 UTSW 7 139,507,804 (GRCm39) missense probably damaging 1.00
R5525:Kndc1 UTSW 7 139,504,026 (GRCm39) missense probably benign 0.00
R5888:Kndc1 UTSW 7 139,475,133 (GRCm39) missense probably benign 0.00
R5942:Kndc1 UTSW 7 139,516,792 (GRCm39) missense probably damaging 1.00
R5979:Kndc1 UTSW 7 139,519,740 (GRCm39) missense probably benign 0.05
R5990:Kndc1 UTSW 7 139,507,333 (GRCm39) missense probably damaging 0.99
R6038:Kndc1 UTSW 7 139,503,691 (GRCm39) frame shift probably null
R6076:Kndc1 UTSW 7 139,481,954 (GRCm39) missense probably damaging 1.00
R6118:Kndc1 UTSW 7 139,503,717 (GRCm39) missense probably damaging 1.00
R6151:Kndc1 UTSW 7 139,501,129 (GRCm39) missense probably benign 0.04
R6276:Kndc1 UTSW 7 139,500,979 (GRCm39) missense probably benign
R6367:Kndc1 UTSW 7 139,493,422 (GRCm39) missense probably damaging 1.00
R6726:Kndc1 UTSW 7 139,502,667 (GRCm39) critical splice donor site probably null
R6745:Kndc1 UTSW 7 139,500,892 (GRCm39) missense probably benign 0.02
R6886:Kndc1 UTSW 7 139,493,485 (GRCm39) missense probably benign 0.01
R6912:Kndc1 UTSW 7 139,490,194 (GRCm39) missense probably damaging 0.99
R7070:Kndc1 UTSW 7 139,501,744 (GRCm39) missense probably damaging 1.00
R7123:Kndc1 UTSW 7 139,516,749 (GRCm39) missense probably damaging 0.99
R7248:Kndc1 UTSW 7 139,500,699 (GRCm39) missense probably damaging 1.00
R7437:Kndc1 UTSW 7 139,488,959 (GRCm39) missense probably damaging 1.00
R7564:Kndc1 UTSW 7 139,500,612 (GRCm39) missense probably benign 0.01
R7570:Kndc1 UTSW 7 139,503,691 (GRCm39) frame shift probably null
R7625:Kndc1 UTSW 7 139,517,930 (GRCm39) missense possibly damaging 0.90
R7629:Kndc1 UTSW 7 139,475,176 (GRCm39) missense probably damaging 1.00
R7726:Kndc1 UTSW 7 139,519,751 (GRCm39) missense possibly damaging 0.67
R7840:Kndc1 UTSW 7 139,503,731 (GRCm39) missense probably damaging 1.00
R7859:Kndc1 UTSW 7 139,500,880 (GRCm39) missense possibly damaging 0.57
R7934:Kndc1 UTSW 7 139,501,402 (GRCm39) missense probably benign 0.02
R8011:Kndc1 UTSW 7 139,490,536 (GRCm39) missense possibly damaging 0.90
R8062:Kndc1 UTSW 7 139,498,760 (GRCm39) missense probably benign 0.01
R8134:Kndc1 UTSW 7 139,481,285 (GRCm39) splice site probably null
R8197:Kndc1 UTSW 7 139,493,447 (GRCm39) missense probably damaging 1.00
R8350:Kndc1 UTSW 7 139,503,960 (GRCm39) missense probably damaging 1.00
R8399:Kndc1 UTSW 7 139,493,434 (GRCm39) missense probably damaging 1.00
R8400:Kndc1 UTSW 7 139,493,434 (GRCm39) missense probably damaging 1.00
R8447:Kndc1 UTSW 7 139,481,121 (GRCm39) missense probably damaging 1.00
R8534:Kndc1 UTSW 7 139,503,669 (GRCm39) missense probably benign 0.27
R8735:Kndc1 UTSW 7 139,490,130 (GRCm39) missense probably benign 0.00
R8816:Kndc1 UTSW 7 139,517,909 (GRCm39) missense probably damaging 1.00
R8883:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8899:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139,503,976 (GRCm39) missense possibly damaging 0.95
R9002:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9010:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9065:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9066:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9223:Kndc1 UTSW 7 139,501,357 (GRCm39) missense possibly damaging 0.89
R9230:Kndc1 UTSW 7 139,500,600 (GRCm39) missense probably damaging 1.00
R9291:Kndc1 UTSW 7 139,475,140 (GRCm39) missense possibly damaging 0.55
R9441:Kndc1 UTSW 7 139,501,392 (GRCm39) missense probably damaging 0.99
R9476:Kndc1 UTSW 7 139,510,031 (GRCm39) missense probably benign 0.00
R9510:Kndc1 UTSW 7 139,510,031 (GRCm39) missense probably benign 0.00
R9518:Kndc1 UTSW 7 139,519,827 (GRCm39) missense probably damaging 1.00
R9758:Kndc1 UTSW 7 139,500,620 (GRCm39) missense possibly damaging 0.71
Z1177:Kndc1 UTSW 7 139,501,828 (GRCm39) missense possibly damaging 0.63
Z1186:Kndc1 UTSW 7 139,490,729 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCAGAGCTTCTCTTGGAGAC -3'
(R):5'- GTCTCCCTGTTTTAAAGACAGAACG -3'

Sequencing Primer
(F):5'- TCTCTTGGAGACTGCCTCGG -3'
(R):5'- CCTGTTTTAAAGACAGAACGTGTGC -3'
Posted On 2019-06-26