Mutagenetix > Incidental Mutations

Incidental Mutation 'R7158:Shprh'

557451

Institutional Source

Beutler Lab

Gene Symbol

Shprh

Ensembl Gene

ENSMUSG00000090112

Gene Name

SNF2 histone linker PHD RING helicase

Synonyms

2610103K11Rik, D230017O13Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7158 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

11149427-11217595 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 11166730 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 819 (T819I)

Ref Sequence

ENSEMBL: ENSMUSP00000039422 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044053] [ENSMUST00000054814] [ENSMUST00000159541] [ENSMUST00000159810] [ENSMUST00000160461]

Predicted Effect

probably damaging
Transcript: ENSMUST00000044053
AA Change: T819I

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000039422
Gene: ENSMUSG00000090112
AA Change: T819I

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
Blast:DEXDc	195	250	3e-12	BLAST
low complexity region	253	265	N/A	INTRINSIC
DEXDc	295	866	4.02e-17	SMART
H15	431	497	3.76e-5	SMART
PHD	651	698	2.33e-5	SMART
low complexity region	1393	1404	N/A	INTRINSIC
RING	1423	1469	9.68e-3	SMART
Pfam:Helicase_C	1500	1613	1.6e-8	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000054814
AA Change: T819I

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000125849
Gene: ENSMUSG00000090112
AA Change: T819I

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
Blast:DEXDc	195	250	3e-12	BLAST
low complexity region	253	265	N/A	INTRINSIC
DEXDc	295	866	4.02e-17	SMART
H15	431	497	3.76e-5	SMART
PHD	651	698	2.33e-5	SMART
low complexity region	1393	1404	N/A	INTRINSIC
RING	1423	1469	9.68e-3	SMART
SCOP:d1fuka_	1504	1616	6e-8	SMART
Blast:HELICc	1533	1613	4e-46	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000159541
AA Change: T819I

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000132870
Gene: ENSMUSG00000090112
AA Change: T819I

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
Blast:DEXDc	195	250	3e-12	BLAST
low complexity region	253	265	N/A	INTRINSIC
DEXDc	295	866	4.02e-17	SMART
H15	431	497	3.76e-5	SMART
PHD	651	698	2.33e-5	SMART
low complexity region	1393	1404	N/A	INTRINSIC
RING	1423	1469	9.68e-3	SMART
SCOP:d1fuka_	1504	1619	4e-8	SMART
Blast:HELICc	1533	1613	6e-46	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000159810
AA Change: T819I

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000125457
Gene: ENSMUSG00000090112
AA Change: T819I

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
Blast:DEXDc	195	250	2e-12	BLAST
low complexity region	253	265	N/A	INTRINSIC
DEXDc	295	866	4.02e-17	SMART
H15	431	497	3.76e-5	SMART
PHD	651	698	2.33e-5	SMART
Blast:DEXDc	948	1026	2e-9	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000160461

SMART Domains

Protein: ENSMUSP00000125127
Gene: ENSMUSG00000090112

Domain	Start	End	E-Value	Type
PHD	131	178	2.33e-5	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHPRH is a ubiquitously expressed protein that contains motifs characteristics of several DNA repair proteins, transcription factors, and helicases. SHPRH is a functional homolog of S. cerevisiae RAD5 (Unk et al., 2006 [PubMed 17108083]).[supplied by OMIM, Mar 2008]
PHENOTYPE: The gene product is an E3 ligase involved in poly-ubiquitination of Pcna. Neither homozygous truncation nor KO affect B cell somatic hypermutation or class switching. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	T	11: 9,273,982	M454L	probably benign	Het
Abca8b	T	A	11: 109,934,589	E1595V	probably damaging	Het
Actr5	T	A	2: 158,626,414	C155S	possibly damaging	Het
Acvr1b	T	A	15: 101,194,058	V73E	probably benign	Het
Add2	T	C	6: 86,085,952	Y31H	probably damaging	Het
Akap13	G	T	7: 75,579,594	V92F	probably damaging	Het
Alox8	T	A	11: 69,185,870	M568L	probably benign	Het
Birc6	A	T	17: 74,594,376	E1145V	probably benign	Het
Cacng1	A	T	11: 107,703,839	M166K	probably damaging	Het
Ces1f	A	G	8: 93,268,016	F256L	probably benign	Het
Clpb	A	G	7: 101,663,832	R8G	probably benign	Het
Col6a5	A	G	9: 105,864,208	V2504A	possibly damaging	Het
Coq8a	T	C	1: 180,179,184	D93G	probably benign	Het
Cry2	A	T	2: 92,413,715	I371N	probably damaging	Het
Ddx43	A	C	9: 78,412,219	Q276H	probably damaging	Het
Dock10	T	C	1: 80,586,872		probably null	Het
Dst	A	G	1: 34,274,285	T4378A	probably benign	Het
Fezf1	T	C	6: 23,245,790	T459A	probably benign	Het
Gm10097	C	T	10: 5,069,407	A72V	unknown	Het
Hydin	A	G	8: 110,609,671	S5027G	possibly damaging	Het
Inhbb	A	T	1: 119,421,022	L22*	probably null	Het
Kat8	G	A	7: 127,922,159	G228S	probably benign	Het
Kif15	T	A	9: 122,999,314	S897T	probably benign	Het
Kndc1	A	G	7: 139,931,860	Y1460C	possibly damaging	Het
Krt78	T	A	15: 101,951,806	D225V	probably benign	Het
Lama3	A	T	18: 12,456,812	I800F	probably benign	Het
Mdn1	C	A	4: 32,725,121	T2580K	probably benign	Het
Mest	T	C	6: 30,744,914	F201S	possibly damaging	Het
Mtmr9	A	G	14: 63,526,869	F470L	probably benign	Het
Nfic	C	T	10: 81,420,605	R75Q	probably damaging	Het
Nme2	G	A	11: 93,955,658		probably benign	Het
Nrg4	A	G	9: 55,242,100	L71P	probably damaging	Het
Pacsin2	C	T	15: 83,379,742	E365K	possibly damaging	Het
Pappa	T	C	4: 65,204,867	I813T	possibly damaging	Het
Pcdhgb4	A	G	18: 37,720,885	E111G	probably damaging	Het
Pdzd8	C	T	19: 59,300,157	R937H	probably damaging	Het
Per1	T	G	11: 69,104,104		probably benign	Het
Pex2	A	G	3: 5,561,336	F138L	probably benign	Het
Pold1	A	T	7: 44,538,866	N529K	probably damaging	Het
Pou6f2	T	C	13: 18,152,038	I316V		Het
Prom1	A	C	5: 44,012,913	I682S	probably damaging	Het
Prpf40a	T	C	2: 53,152,553	K481E	probably damaging	Het
Prrg4	A	T	2: 104,832,613	V216E	probably damaging	Het
Ptch2	C	T	4: 117,114,784	P1168S	possibly damaging	Het
Pvr	C	A	7: 19,918,637	E118*	probably null	Het
R3hcc1l	C	T	19: 42,583,429	P716S	probably damaging	Het
Rasa4	A	G	5: 136,102,021	E382G	probably damaging	Het
Rbp3	T	A	14: 33,955,556	M487K	probably benign	Het
Rsad2	A	T	12: 26,450,780		probably null	Het
Shmt1	T	C	11: 60,790,242	I353V	probably benign	Het
Skap1	T	A	11: 96,526,057	F56Y	possibly damaging	Het
Slc22a16	G	T	10: 40,573,741	V79L	possibly damaging	Het
Slc34a1	A	G	13: 55,401,231	T165A	probably damaging	Het
Smchd1	A	C	17: 71,400,150	I941R	probably damaging	Het
Syne1	C	A	10: 5,057,931	V98F	probably damaging	Het
Tcaim	A	G	9: 122,818,990	D190G	possibly damaging	Het
Tdrd9	G	C	12: 112,036,366	E816D	probably benign	Het
Tmem132d	T	C	5: 128,137,019	K326E	possibly damaging	Het
Uhrf1bp1	T	A	17: 27,886,433	C644*	probably null	Het
Usp35	T	C	7: 97,325,964	M1V	probably null	Het
Wdr62	C	T	7: 30,270,738	V215I	possibly damaging	Het
Zan	T	C	5: 137,400,644	T4153A	unknown	Het
Zfp239	G	T	6: 117,871,729	E143*	probably null	Het
Zfp292	T	C	4: 34,808,679	D1460G	probably benign	Het
Zfp647	C	T	15: 76,917,305	G90R	probably benign	Het

Other mutations in Shprh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00492:Shprh	APN	10	11188158	missense	probably damaging	1.00
IGL00583:Shprh	APN	10	11188020	missense	probably benign	0.37
IGL00684:Shprh	APN	10	11163037	missense	probably benign	0.11
IGL01295:Shprh	APN	10	11183868	missense	probably damaging	0.96
IGL01387:Shprh	APN	10	11170254	missense	probably damaging	1.00
IGL01635:Shprh	APN	10	11170019	nonsense	probably null
IGL01833:Shprh	APN	10	11191062	missense	probably damaging	1.00
IGL02013:Shprh	APN	10	11181502	splice site	probably benign
IGL02502:Shprh	APN	10	11194357	missense	possibly damaging	0.66
IGL02819:Shprh	APN	10	11154765	missense	possibly damaging	0.93
PIT4581001:Shprh	UTSW	10	11192494	frame shift	probably null
R0010:Shprh	UTSW	10	11151931	missense	probably benign
R0010:Shprh	UTSW	10	11151931	missense	probably benign
R0053:Shprh	UTSW	10	11194372	splice site	probably null
R0053:Shprh	UTSW	10	11194372	splice site	probably null
R0255:Shprh	UTSW	10	11186391	missense	possibly damaging	0.92
R0325:Shprh	UTSW	10	11170109	missense	probably benign	0.00
R0331:Shprh	UTSW	10	11194170	splice site	probably benign
R0494:Shprh	UTSW	10	11157191	missense	probably damaging	1.00
R0532:Shprh	UTSW	10	11162812	missense	possibly damaging	0.90
R0546:Shprh	UTSW	10	11183887	splice site	probably benign
R0574:Shprh	UTSW	10	11163077	unclassified	probably benign
R0605:Shprh	UTSW	10	11207112	missense	probably damaging	1.00
R0662:Shprh	UTSW	10	11186847	missense	probably damaging	1.00
R1148:Shprh	UTSW	10	11213482	missense	possibly damaging	0.95
R1148:Shprh	UTSW	10	11213482	missense	possibly damaging	0.95
R1263:Shprh	UTSW	10	11159530	missense	probably damaging	1.00
R1588:Shprh	UTSW	10	11164744	missense	probably damaging	1.00
R1638:Shprh	UTSW	10	11157078	missense	probably benign
R1830:Shprh	UTSW	10	11186911	splice site	probably null
R1898:Shprh	UTSW	10	11186869	missense	probably damaging	1.00
R1903:Shprh	UTSW	10	11183797	nonsense	probably null
R2060:Shprh	UTSW	10	11152120	missense	probably benign	0.03
R2225:Shprh	UTSW	10	11162235	unclassified	probably benign
R2363:Shprh	UTSW	10	11171953	missense	probably damaging	1.00
R2509:Shprh	UTSW	10	11166724	missense	probably damaging	1.00
R2891:Shprh	UTSW	10	11164356	missense	probably damaging	1.00
R3077:Shprh	UTSW	10	11170413	missense	probably damaging	1.00
R3150:Shprh	UTSW	10	11170030	missense	probably damaging	0.97
R3796:Shprh	UTSW	10	11178757	missense	possibly damaging	0.89
R4196:Shprh	UTSW	10	11207860	utr 3 prime	probably benign
R4423:Shprh	UTSW	10	11186518	missense	possibly damaging	0.82
R4488:Shprh	UTSW	10	11160471	missense	probably benign	0.17
R4748:Shprh	UTSW	10	11170476	missense	probably damaging	1.00
R4768:Shprh	UTSW	10	11181540	missense	probably damaging	0.96
R4867:Shprh	UTSW	10	11164557	missense	probably benign	0.00
R4937:Shprh	UTSW	10	11157119	missense	probably benign
R5140:Shprh	UTSW	10	11154705	missense	probably benign	0.03
R5318:Shprh	UTSW	10	11166557	missense	probably benign	0.04
R5323:Shprh	UTSW	10	11170297	splice site	probably null
R5450:Shprh	UTSW	10	11212330	missense	possibly damaging	0.70
R5872:Shprh	UTSW	10	11188073	missense	probably damaging	1.00
R6030:Shprh	UTSW	10	11151991	missense	probably benign	0.37
R6030:Shprh	UTSW	10	11151991	missense	probably benign	0.37
R6392:Shprh	UTSW	10	11178741	nonsense	probably null
R6416:Shprh	UTSW	10	11167873	missense	probably damaging	1.00
R6470:Shprh	UTSW	10	11171937	missense	probably damaging	0.98
R6513:Shprh	UTSW	10	11186893	missense	probably damaging	1.00
R6530:Shprh	UTSW	10	11194267	missense	probably benign	0.02
R6678:Shprh	UTSW	10	11166545	missense	probably benign	0.16
R6757:Shprh	UTSW	10	11181508	splice site	probably null
R6971:Shprh	UTSW	10	11166693	missense	probably damaging	1.00
R7582:Shprh	UTSW	10	11164705	missense	probably benign
R7757:Shprh	UTSW	10	11162180	missense	probably benign	0.30
R7812:Shprh	UTSW	10	11151991	missense	probably benign
R7998:Shprh	UTSW	10	11185341	missense	probably damaging	1.00
R8061:Shprh	UTSW	10	11212333	missense	possibly damaging	0.71
R8082:Shprh	UTSW	10	11151811	missense	probably benign	0.22
R8116:Shprh	UTSW	10	11213461	missense	probably damaging	0.99
R8390:Shprh	UTSW	10	11187983	missense	possibly damaging	0.92
R8445:Shprh	UTSW	10	11181569	missense	possibly damaging	0.92
RF012:Shprh	UTSW	10	11164841	missense	probably benign	0.02
V8831:Shprh	UTSW	10	11186862	missense	probably damaging	1.00
Z1176:Shprh	UTSW	10	11164553	missense	probably benign
Z1176:Shprh	UTSW	10	11186447	missense	probably damaging	1.00
Z1177:Shprh	UTSW	10	11151762	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- AAGAAACACGGCTTCTTACAGC -3'
(R):5'- GTCATACACACAGATATCCAAGTAGTC -3'

Sequencing Primer
(F):5'- CCCACATAGCAATAGTGAAG -3'
(R):5'- GTAGTCCATACAAAACTATCATCCAG -3'

Posted On

2019-06-26