Incidental Mutation 'R7158:Nfic'
ID557453
Institutional Source Beutler Lab
Gene Symbol Nfic
Ensembl Gene ENSMUSG00000055053
Gene Namenuclear factor I/C
Synonymsnuclear factor 1-C2, 1110019L22Rik, NF1-C, 1500041O16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.553) question?
Stock #R7158 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location81396186-81455635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 81420605 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 75 (R75Q)
Ref Sequence ENSEMBL: ENSMUSP00000100958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020461] [ENSMUST00000078185] [ENSMUST00000105321] [ENSMUST00000117966] [ENSMUST00000221817]
Predicted Effect probably damaging
Transcript: ENSMUST00000020461
AA Change: R75Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000020461
Gene: ENSMUSG00000055053
AA Change: R75Q

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 7 47 4.6e-30 PFAM
DWA 68 176 5.77e-24 SMART
Pfam:CTF_NFI 217 428 2e-107 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000078185
AA Change: R75Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077317
Gene: ENSMUSG00000055053
AA Change: R75Q

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 4 47 9.5e-31 PFAM
DWA 68 176 5.77e-24 SMART
Pfam:CTF_NFI 217 323 1.4e-52 PFAM
Pfam:CTF_NFI 316 387 1.7e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105321
AA Change: R75Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000100958
Gene: ENSMUSG00000055053
AA Change: R75Q

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 4 47 8e-31 PFAM
DWA 68 176 5.77e-24 SMART
Pfam:CTF_NFI 217 426 5.2e-106 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117966
AA Change: R66Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113046
Gene: ENSMUSG00000055053
AA Change: R66Q

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 1 38 1.3e-27 PFAM
DWA 59 167 5.77e-24 SMART
Pfam:CTF_NFI 208 421 1.9e-106 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000221817
AA Change: R97Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the CTF/NF-I family. These are dimeric DNA-binding proteins, and function as cellular transcription factors and as replication factors for adenovirus DNA replication. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null allele have abnormal incisor and molar root development, show reduced alveolar bone formation, and exhibit impaired feeding leading to severe runting and premature death when reared on standard laboratory chow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,273,982 M454L probably benign Het
Abca8b T A 11: 109,934,589 E1595V probably damaging Het
Actr5 T A 2: 158,626,414 C155S possibly damaging Het
Acvr1b T A 15: 101,194,058 V73E probably benign Het
Add2 T C 6: 86,085,952 Y31H probably damaging Het
Akap13 G T 7: 75,579,594 V92F probably damaging Het
Alox8 T A 11: 69,185,870 M568L probably benign Het
Birc6 A T 17: 74,594,376 E1145V probably benign Het
Cacng1 A T 11: 107,703,839 M166K probably damaging Het
Ces1f A G 8: 93,268,016 F256L probably benign Het
Clpb A G 7: 101,663,832 R8G probably benign Het
Col6a5 A G 9: 105,864,208 V2504A possibly damaging Het
Coq8a T C 1: 180,179,184 D93G probably benign Het
Cry2 A T 2: 92,413,715 I371N probably damaging Het
Ddx43 A C 9: 78,412,219 Q276H probably damaging Het
Dock10 T C 1: 80,586,872 probably null Het
Dst A G 1: 34,274,285 T4378A probably benign Het
Fezf1 T C 6: 23,245,790 T459A probably benign Het
Gm10097 C T 10: 5,069,407 A72V unknown Het
Hydin A G 8: 110,609,671 S5027G possibly damaging Het
Inhbb A T 1: 119,421,022 L22* probably null Het
Kat8 G A 7: 127,922,159 G228S probably benign Het
Kif15 T A 9: 122,999,314 S897T probably benign Het
Kndc1 A G 7: 139,931,860 Y1460C possibly damaging Het
Krt78 T A 15: 101,951,806 D225V probably benign Het
Lama3 A T 18: 12,456,812 I800F probably benign Het
Mdn1 C A 4: 32,725,121 T2580K probably benign Het
Mest T C 6: 30,744,914 F201S possibly damaging Het
Mtmr9 A G 14: 63,526,869 F470L probably benign Het
Nme2 G A 11: 93,955,658 probably benign Het
Nrg4 A G 9: 55,242,100 L71P probably damaging Het
Pacsin2 C T 15: 83,379,742 E365K possibly damaging Het
Pappa T C 4: 65,204,867 I813T possibly damaging Het
Pcdhgb4 A G 18: 37,720,885 E111G probably damaging Het
Pdzd8 C T 19: 59,300,157 R937H probably damaging Het
Per1 T G 11: 69,104,104 probably benign Het
Pex2 A G 3: 5,561,336 F138L probably benign Het
Pold1 A T 7: 44,538,866 N529K probably damaging Het
Pou6f2 T C 13: 18,152,038 I316V Het
Prom1 A C 5: 44,012,913 I682S probably damaging Het
Prpf40a T C 2: 53,152,553 K481E probably damaging Het
Prrg4 A T 2: 104,832,613 V216E probably damaging Het
Ptch2 C T 4: 117,114,784 P1168S possibly damaging Het
Pvr C A 7: 19,918,637 E118* probably null Het
R3hcc1l C T 19: 42,583,429 P716S probably damaging Het
Rasa4 A G 5: 136,102,021 E382G probably damaging Het
Rbp3 T A 14: 33,955,556 M487K probably benign Het
Rsad2 A T 12: 26,450,780 probably null Het
Shmt1 T C 11: 60,790,242 I353V probably benign Het
Shprh C T 10: 11,166,730 T819I probably damaging Het
Skap1 T A 11: 96,526,057 F56Y possibly damaging Het
Slc22a16 G T 10: 40,573,741 V79L possibly damaging Het
Slc34a1 A G 13: 55,401,231 T165A probably damaging Het
Smchd1 A C 17: 71,400,150 I941R probably damaging Het
Syne1 C A 10: 5,057,931 V98F probably damaging Het
Tcaim A G 9: 122,818,990 D190G possibly damaging Het
Tdrd9 G C 12: 112,036,366 E816D probably benign Het
Tmem132d T C 5: 128,137,019 K326E possibly damaging Het
Uhrf1bp1 T A 17: 27,886,433 C644* probably null Het
Usp35 T C 7: 97,325,964 M1V probably null Het
Wdr62 C T 7: 30,270,738 V215I possibly damaging Het
Zan T C 5: 137,400,644 T4153A unknown Het
Zfp239 G T 6: 117,871,729 E143* probably null Het
Zfp292 T C 4: 34,808,679 D1460G probably benign Het
Zfp647 C T 15: 76,917,305 G90R probably benign Het
Other mutations in Nfic
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Nfic APN 10 81408220 missense possibly damaging 0.94
IGL01486:Nfic APN 10 81407644 unclassified probably null
IGL01784:Nfic APN 10 81406148 missense possibly damaging 0.70
IGL02053:Nfic APN 10 81420551 missense probably damaging 1.00
IGL03128:Nfic APN 10 81406191 missense probably benign 0.21
sterb UTSW 10 81420800 critical splice acceptor site probably null
R0113:Nfic UTSW 10 81420585 missense probably damaging 1.00
R1468:Nfic UTSW 10 81420580 missense probably damaging 1.00
R1468:Nfic UTSW 10 81420580 missense probably damaging 1.00
R1807:Nfic UTSW 10 81404985 missense probably benign 0.21
R1872:Nfic UTSW 10 81420684 missense possibly damaging 0.89
R2295:Nfic UTSW 10 81420531 missense probably damaging 1.00
R2324:Nfic UTSW 10 81406087 critical splice donor site probably null
R5992:Nfic UTSW 10 81420747 missense probably damaging 1.00
R6260:Nfic UTSW 10 81420517 nonsense probably null
R6972:Nfic UTSW 10 81420357 missense probably benign 0.00
R6973:Nfic UTSW 10 81420357 missense probably benign 0.00
R6982:Nfic UTSW 10 81420800 critical splice acceptor site probably null
R7682:Nfic UTSW 10 81420500 missense probably damaging 1.00
X0065:Nfic UTSW 10 81427098 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATGACCATGACCAGGTCCAGAC -3'
(R):5'- TAAGCCTCAGTTTGCCTGC -3'

Sequencing Primer
(F):5'- AGACGCCACACTTTGTCG -3'
(R):5'- ATGAGTTCCACCCGTTCATCGAG -3'
Posted On2019-06-26