Incidental Mutation 'R7159:Rc3h2'
ID557480
Institutional Source Beutler Lab
Gene Symbol Rc3h2
Ensembl Gene ENSMUSG00000075376
Gene Namering finger and CCCH-type zinc finger domains 2
SynonymsMnab, D930043C02Rik, Rnf164, 2900024N03Rik, 9430019J22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7159 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location37370069-37422903 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37409647 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 124 (S124G)
Ref Sequence ENSEMBL: ENSMUSP00000108556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100143] [ENSMUST00000112934] [ENSMUST00000112936] [ENSMUST00000125619]
Predicted Effect probably benign
Transcript: ENSMUST00000100143
AA Change: S124G

PolyPhen 2 Score 0.388 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097721
Gene: ENSMUSG00000075376
AA Change: S124G

DomainStartEndE-ValueType
RING 14 53 2.87e-5 SMART
low complexity region 198 209 N/A INTRINSIC
ZnF_C3H1 410 437 1.58e-3 SMART
low complexity region 609 633 N/A INTRINSIC
low complexity region 668 688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112934
AA Change: S124G

PolyPhen 2 Score 0.388 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108556
Gene: ENSMUSG00000075376
AA Change: S124G

DomainStartEndE-ValueType
RING 14 53 2.87e-5 SMART
low complexity region 198 209 N/A INTRINSIC
ZnF_C3H1 410 437 1.58e-3 SMART
low complexity region 609 633 N/A INTRINSIC
low complexity region 668 688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112936
AA Change: S124G

PolyPhen 2 Score 0.388 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108558
Gene: ENSMUSG00000075376
AA Change: S124G

DomainStartEndE-ValueType
RING 14 53 2.87e-5 SMART
low complexity region 198 209 N/A INTRINSIC
ZnF_C3H1 410 437 1.58e-3 SMART
low complexity region 609 633 N/A INTRINSIC
low complexity region 668 688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125619
AA Change: S124G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000145082
Gene: ENSMUSG00000075376
AA Change: S124G

DomainStartEndE-ValueType
RING 14 53 1.4e-7 SMART
low complexity region 198 209 N/A INTRINSIC
ZnF_C3H1 410 437 6.9e-6 SMART
low complexity region 455 466 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (70/71)
MGI Phenotype PHENOTYPE: Homozygotes for a knock-out allele are viable and healthy but show increased TNF production by macrophages in response to LPS. Homozygotes for a different knock-out allele show postnatal lethality, decreased body size and weight, and an immature lung phenotype with decreased alveolar expansion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T A 7: 75,730,579 V500E possibly damaging Het
Ankrd34b T C 13: 92,439,462 S401P probably benign Het
Arfgef2 T A 2: 166,826,928 D41E probably benign Het
Arid1a T C 4: 133,753,568 N15S unknown Het
Arsa A T 15: 89,474,718 probably null Het
B3gnt9 C A 8: 105,254,432 C108F probably damaging Het
Bbc3 C A 7: 16,313,808 Y152* probably null Het
Btbd1 T C 7: 81,818,209 M188V probably benign Het
Caln1 C T 5: 130,822,997 T209I probably benign Het
Casp12 C T 9: 5,353,763 P266S possibly damaging Het
Ccm2l A T 2: 153,070,867 I109F probably damaging Het
Chst15 A C 7: 132,270,258 L98R probably damaging Het
Ctsq A G 13: 61,038,923 M89T probably benign Het
Ddx39b T C 17: 35,247,010 V169A probably benign Het
Ddx58 A G 4: 40,213,804 V618A probably benign Het
Fam57b T C 7: 126,827,495 F80S probably damaging Het
Fhad1 T C 4: 141,951,616 H583R probably benign Het
Fndc1 T A 17: 7,800,931 I139F probably damaging Het
Gm5724 T A 6: 141,773,778 M1L probably damaging Het
Gm7145 C G 1: 117,985,831 H148D probably benign Het
Gpr62 C A 9: 106,465,442 A96S probably damaging Het
Gsap T A 5: 21,270,620 probably null Het
Hdhd5 T A 6: 120,523,471 T89S probably damaging Het
Kcna5 T A 6: 126,533,629 Y512F probably damaging Het
Krt84 C A 15: 101,529,609 E304* probably null Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lrp6 C A 6: 134,507,551 V370L probably benign Het
Lrrc3c G A 11: 98,599,318 G167D probably damaging Het
Man2b1 C T 8: 85,087,280 T291M probably benign Het
Mapkbp1 A G 2: 120,025,132 E1438G possibly damaging Het
Med12l A G 3: 59,276,017 T1947A probably benign Het
Myh15 A T 16: 49,061,574 T60S probably damaging Het
Myo5a A T 9: 75,171,563 I868F probably benign Het
Myom3 A T 4: 135,808,851 I1278F probably damaging Het
Nbn G T 4: 15,983,677 probably null Het
Ncam2 G T 16: 81,490,374 S392I probably damaging Het
Nrg3 A C 14: 38,370,735 L647* probably null Het
Olfr1062 T A 2: 86,423,612 probably null Het
Olfr1393 A T 11: 49,280,358 D70V probably damaging Het
Olfr1406 A T 1: 173,184,323 L37Q possibly damaging Het
Olfr721-ps1 T C 14: 14,407,251 S8P possibly damaging Het
Pcdhb9 A G 18: 37,401,492 N180D possibly damaging Het
Pcdhga4 A G 18: 37,686,919 N507S probably damaging Het
Pdilt A G 7: 119,487,951 V492A probably benign Het
Phf12 A G 11: 78,023,540 T603A possibly damaging Het
Phox2b T A 5: 67,097,585 I174F probably benign Het
Polq A T 16: 37,062,853 Q1793L possibly damaging Het
Prmt9 T C 8: 77,555,764 F97L probably benign Het
Prpsap1 T C 11: 116,494,044 E13G probably benign Het
Ptpru A G 4: 131,819,540 L280P probably damaging Het
Pygl A T 12: 70,197,406 M587K probably benign Het
Rdh5 A G 10: 128,918,315 I83T possibly damaging Het
Ryr2 T G 13: 11,810,908 R561S probably damaging Het
Scara3 A G 14: 65,920,780 L593P probably damaging Het
Scfd2 T C 5: 74,531,343 I93V probably benign Het
Sema4f C A 6: 82,917,883 V444L possibly damaging Het
Spata33 T C 8: 123,214,395 L61P unknown Het
Stard10 A T 7: 101,343,136 probably null Het
Stub1 T C 17: 25,832,064 I115V probably benign Het
Tmem247 C T 17: 86,918,282 T50I probably benign Het
Tnrc6b A G 15: 80,887,022 M1103V possibly damaging Het
Trim61 T C 8: 65,013,874 Y245C probably benign Het
Trip13 T C 13: 73,920,011 I284V probably benign Het
Trpm4 T C 7: 45,327,268 probably null Het
Ttn A G 2: 76,730,574 L29161S probably damaging Het
Ttn C A 2: 76,909,748 L3528F unknown Het
Ube2v2 G A 16: 15,581,084 T47I probably benign Het
Vwa5b1 C T 4: 138,575,422 A921T possibly damaging Het
Xylt1 T A 7: 117,637,602 F526Y probably damaging Het
Other mutations in Rc3h2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Rc3h2 APN 2 37389747 missense possibly damaging 0.59
IGL00944:Rc3h2 APN 2 37398238 splice site probably benign
IGL01065:Rc3h2 APN 2 37377844 splice site probably benign
IGL01966:Rc3h2 APN 2 37382777 splice site probably benign
IGL02123:Rc3h2 APN 2 37398253 missense probably damaging 1.00
IGL02174:Rc3h2 APN 2 37411225 missense probably benign 0.11
IGL02448:Rc3h2 APN 2 37389805 missense probably benign 0.08
IGL02539:Rc3h2 APN 2 37389715 missense probably benign 0.09
IGL02698:Rc3h2 APN 2 37405300 missense probably damaging 0.99
IGL02731:Rc3h2 APN 2 37382811 missense probably benign 0.00
IGL02958:Rc3h2 APN 2 37414700 missense probably damaging 1.00
IGL02959:Rc3h2 APN 2 37405354 missense probably damaging 1.00
PIT4468001:Rc3h2 UTSW 2 37399639 missense probably damaging 1.00
R0309:Rc3h2 UTSW 2 37379008 splice site probably benign
R0488:Rc3h2 UTSW 2 37389588 missense probably damaging 0.99
R0506:Rc3h2 UTSW 2 37376659 critical splice donor site probably null
R0612:Rc3h2 UTSW 2 37411215 missense possibly damaging 0.77
R0628:Rc3h2 UTSW 2 37382052 splice site probably benign
R0647:Rc3h2 UTSW 2 37409530 missense probably damaging 1.00
R0680:Rc3h2 UTSW 2 37399835 missense probably damaging 0.97
R0738:Rc3h2 UTSW 2 37405374 missense probably damaging 1.00
R2005:Rc3h2 UTSW 2 37389753 nonsense probably null
R2105:Rc3h2 UTSW 2 37399624 missense possibly damaging 0.89
R2133:Rc3h2 UTSW 2 37378916 missense probably benign 0.12
R2373:Rc3h2 UTSW 2 37379001 missense possibly damaging 0.94
R2414:Rc3h2 UTSW 2 37399819 critical splice donor site probably null
R2850:Rc3h2 UTSW 2 37377415 missense probably benign
R2913:Rc3h2 UTSW 2 37378959 missense possibly damaging 0.89
R2932:Rc3h2 UTSW 2 37378359 missense probably benign 0.10
R4441:Rc3h2 UTSW 2 37414514 critical splice donor site probably null
R4932:Rc3h2 UTSW 2 37389832 missense possibly damaging 0.77
R5114:Rc3h2 UTSW 2 37398361 splice site probably null
R5169:Rc3h2 UTSW 2 37405312 missense probably damaging 1.00
R5360:Rc3h2 UTSW 2 37389855 missense possibly damaging 0.59
R5477:Rc3h2 UTSW 2 37399630 missense possibly damaging 0.94
R5553:Rc3h2 UTSW 2 37398311 nonsense probably null
R5776:Rc3h2 UTSW 2 37378313 missense possibly damaging 0.59
R5842:Rc3h2 UTSW 2 37378371 missense possibly damaging 0.77
R5935:Rc3h2 UTSW 2 37414733 frame shift probably null
R6060:Rc3h2 UTSW 2 37399600 missense possibly damaging 0.77
R6112:Rc3h2 UTSW 2 37378887 missense possibly damaging 0.59
R6172:Rc3h2 UTSW 2 37414733 frame shift probably null
R6173:Rc3h2 UTSW 2 37414733 frame shift probably null
R6177:Rc3h2 UTSW 2 37389646 missense probably benign 0.02
R6455:Rc3h2 UTSW 2 37409470 missense probably damaging 1.00
R6457:Rc3h2 UTSW 2 37411139 critical splice donor site probably null
R6467:Rc3h2 UTSW 2 37382016 missense probably damaging 0.97
R6647:Rc3h2 UTSW 2 37382944 nonsense probably null
R6694:Rc3h2 UTSW 2 37400543 missense probably damaging 1.00
R6695:Rc3h2 UTSW 2 37414661 missense possibly damaging 0.88
R7054:Rc3h2 UTSW 2 37375246 missense probably benign 0.07
R7162:Rc3h2 UTSW 2 37409605 missense possibly damaging 0.59
R7640:Rc3h2 UTSW 2 37377849 critical splice donor site probably null
R7676:Rc3h2 UTSW 2 37405332 missense possibly damaging 0.95
X0013:Rc3h2 UTSW 2 37389786 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- CCCTAGAAACTGGCATCCTC -3'
(R):5'- GCACCAAGATGAAATCTGAAGC -3'

Sequencing Primer
(F):5'- TAGAAACTGGCATCCTCGAGCC -3'
(R):5'- GGTAAGGAGCACTGACTACTCTTC -3'
Posted On2019-06-26