Incidental Mutation 'R7159:Vwa5b1'
List |< first << previous [record 69 of 70] next >> last >|
ID557491
Institutional Source Beutler Lab
Gene Symbol Vwa5b1
Ensembl Gene ENSMUSG00000028753
Gene Namevon Willebrand factor A domain containing 5B1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7159 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location138565360-138635884 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 138575422 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 921 (A921T)
Ref Sequence ENSEMBL: ENSMUSP00000030533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030533]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030533
AA Change: A921T

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030533
Gene: ENSMUSG00000028753
AA Change: A921T

DomainStartEndE-ValueType
Pfam:VIT_2 2 79 2e-28 PFAM
Pfam:VIT 15 138 1.5e-7 PFAM
VWA 351 513 6.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137206
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (70/71)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T A 7: 75,730,579 V500E possibly damaging Het
Ankrd34b T C 13: 92,439,462 S401P probably benign Het
Arfgef2 T A 2: 166,826,928 D41E probably benign Het
Arid1a T C 4: 133,753,568 N15S unknown Het
Arsa A T 15: 89,474,718 probably null Het
B3gnt9 C A 8: 105,254,432 C108F probably damaging Het
Bbc3 C A 7: 16,313,808 Y152* probably null Het
Btbd1 T C 7: 81,818,209 M188V probably benign Het
Caln1 C T 5: 130,822,997 T209I probably benign Het
Casp12 C T 9: 5,353,763 P266S possibly damaging Het
Ccm2l A T 2: 153,070,867 I109F probably damaging Het
Chst15 A C 7: 132,270,258 L98R probably damaging Het
Ctsq A G 13: 61,038,923 M89T probably benign Het
Ddx39b T C 17: 35,247,010 V169A probably benign Het
Ddx58 A G 4: 40,213,804 V618A probably benign Het
Fam57b T C 7: 126,827,495 F80S probably damaging Het
Fhad1 T C 4: 141,951,616 H583R probably benign Het
Fndc1 T A 17: 7,800,931 I139F probably damaging Het
Gm5724 T A 6: 141,773,778 M1L probably damaging Het
Gm7145 C G 1: 117,985,831 H148D probably benign Het
Gpr62 C A 9: 106,465,442 A96S probably damaging Het
Gsap T A 5: 21,270,620 probably null Het
Hdhd5 T A 6: 120,523,471 T89S probably damaging Het
Kcna5 T A 6: 126,533,629 Y512F probably damaging Het
Krt84 C A 15: 101,529,609 E304* probably null Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lrp6 C A 6: 134,507,551 V370L probably benign Het
Lrrc3c G A 11: 98,599,318 G167D probably damaging Het
Man2b1 C T 8: 85,087,280 T291M probably benign Het
Mapkbp1 A G 2: 120,025,132 E1438G possibly damaging Het
Med12l A G 3: 59,276,017 T1947A probably benign Het
Myh15 A T 16: 49,061,574 T60S probably damaging Het
Myo5a A T 9: 75,171,563 I868F probably benign Het
Myom3 A T 4: 135,808,851 I1278F probably damaging Het
Nbn G T 4: 15,983,677 probably null Het
Ncam2 G T 16: 81,490,374 S392I probably damaging Het
Nrg3 A C 14: 38,370,735 L647* probably null Het
Olfr1062 T A 2: 86,423,612 probably null Het
Olfr1393 A T 11: 49,280,358 D70V probably damaging Het
Olfr1406 A T 1: 173,184,323 L37Q possibly damaging Het
Olfr721-ps1 T C 14: 14,407,251 S8P possibly damaging Het
Pcdhb9 A G 18: 37,401,492 N180D possibly damaging Het
Pcdhga4 A G 18: 37,686,919 N507S probably damaging Het
Pdilt A G 7: 119,487,951 V492A probably benign Het
Phf12 A G 11: 78,023,540 T603A possibly damaging Het
Phox2b T A 5: 67,097,585 I174F probably benign Het
Polq A T 16: 37,062,853 Q1793L possibly damaging Het
Prmt9 T C 8: 77,555,764 F97L probably benign Het
Prpsap1 T C 11: 116,494,044 E13G probably benign Het
Ptpru A G 4: 131,819,540 L280P probably damaging Het
Pygl A T 12: 70,197,406 M587K probably benign Het
Rc3h2 T C 2: 37,409,647 S124G probably benign Het
Rdh5 A G 10: 128,918,315 I83T possibly damaging Het
Ryr2 T G 13: 11,810,908 R561S probably damaging Het
Scara3 A G 14: 65,920,780 L593P probably damaging Het
Scfd2 T C 5: 74,531,343 I93V probably benign Het
Sema4f C A 6: 82,917,883 V444L possibly damaging Het
Spata33 T C 8: 123,214,395 L61P unknown Het
Stard10 A T 7: 101,343,136 probably null Het
Stub1 T C 17: 25,832,064 I115V probably benign Het
Tmem247 C T 17: 86,918,282 T50I probably benign Het
Tnrc6b A G 15: 80,887,022 M1103V possibly damaging Het
Trim61 T C 8: 65,013,874 Y245C probably benign Het
Trip13 T C 13: 73,920,011 I284V probably benign Het
Trpm4 T C 7: 45,327,268 probably null Het
Ttn A G 2: 76,730,574 L29161S probably damaging Het
Ttn C A 2: 76,909,748 L3528F unknown Het
Ube2v2 G A 16: 15,581,084 T47I probably benign Het
Xylt1 T A 7: 117,637,602 F526Y probably damaging Het
Other mutations in Vwa5b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01952:Vwa5b1 APN 4 138581217 missense probably benign 0.08
IGL02133:Vwa5b1 APN 4 138586557 critical splice donor site probably null
IGL02379:Vwa5b1 APN 4 138612859 missense probably damaging 1.00
IGL02671:Vwa5b1 APN 4 138569126 nonsense probably null
IGL02864:Vwa5b1 APN 4 138608975 missense probably benign 0.00
IGL03076:Vwa5b1 APN 4 138600188 missense probably damaging 1.00
IGL03115:Vwa5b1 APN 4 138600149 missense possibly damaging 0.93
IGL03119:Vwa5b1 APN 4 138606541 missense probably benign 0.01
PIT4283001:Vwa5b1 UTSW 4 138600263 missense probably damaging 1.00
R0114:Vwa5b1 UTSW 4 138608858 nonsense probably null
R0157:Vwa5b1 UTSW 4 138604879 missense probably benign 0.00
R0528:Vwa5b1 UTSW 4 138594351 missense probably damaging 1.00
R0562:Vwa5b1 UTSW 4 138635711 splice site probably benign
R0718:Vwa5b1 UTSW 4 138608824 missense probably damaging 1.00
R1555:Vwa5b1 UTSW 4 138605477 missense probably benign 0.02
R1573:Vwa5b1 UTSW 4 138604873 missense probably damaging 1.00
R1857:Vwa5b1 UTSW 4 138569102 missense probably damaging 1.00
R1883:Vwa5b1 UTSW 4 138575389 missense probably damaging 0.96
R1906:Vwa5b1 UTSW 4 138600236 missense possibly damaging 0.93
R1913:Vwa5b1 UTSW 4 138592020 nonsense probably null
R2121:Vwa5b1 UTSW 4 138588569 missense probably benign 0.00
R2213:Vwa5b1 UTSW 4 138604812 missense probably benign 0.00
R2355:Vwa5b1 UTSW 4 138591910 critical splice donor site probably null
R2655:Vwa5b1 UTSW 4 138594303 missense probably damaging 1.00
R4134:Vwa5b1 UTSW 4 138594330 missense possibly damaging 0.69
R4135:Vwa5b1 UTSW 4 138594330 missense possibly damaging 0.69
R4635:Vwa5b1 UTSW 4 138610839 missense possibly damaging 0.82
R4773:Vwa5b1 UTSW 4 138581755 missense probably benign 0.01
R4832:Vwa5b1 UTSW 4 138605540 missense probably damaging 1.00
R4906:Vwa5b1 UTSW 4 138610747 missense probably benign 0.03
R4916:Vwa5b1 UTSW 4 138594262 missense possibly damaging 0.81
R4995:Vwa5b1 UTSW 4 138608843 missense probably damaging 1.00
R5573:Vwa5b1 UTSW 4 138608890 missense probably damaging 1.00
R5872:Vwa5b1 UTSW 4 138578651 missense possibly damaging 0.63
R6255:Vwa5b1 UTSW 4 138578672 missense probably benign 0.00
R6811:Vwa5b1 UTSW 4 138592103 missense probably benign 0.00
R6901:Vwa5b1 UTSW 4 138586569 missense probably benign
R7144:Vwa5b1 UTSW 4 138605431 critical splice donor site probably null
R7146:Vwa5b1 UTSW 4 138581612 missense probably benign 0.00
R7362:Vwa5b1 UTSW 4 138594312 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGACTGCAGACTCAGAGAGC -3'
(R):5'- TCTGGAGCTTCACAGACCTG -3'

Sequencing Primer
(F):5'- AGACTCAGAGAGCAGCCCG -3'
(R):5'- CCATTCTCCAGATTGGGAAACTGAG -3'
Posted On2019-06-26