Incidental Mutation 'R0586:Clcn6'
ID 55750
Institutional Source Beutler Lab
Gene Symbol Clcn6
Ensembl Gene ENSMUSG00000029016
Gene Name chloride channel, voltage-sensitive 6
Synonyms
MMRRC Submission 038776-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R0586 (G1)
Quality Score 118
Status Validated
Chromosome 4
Chromosomal Location 148088716-148123270 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) A to G at 148123206 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030879] [ENSMUST00000069604] [ENSMUST00000097788] [ENSMUST00000105711] [ENSMUST00000131232] [ENSMUST00000137724] [ENSMUST00000152498] [ENSMUST00000141283]
AlphaFold O35454
Predicted Effect unknown
Transcript: ENSMUST00000030879
AA Change: S7P
SMART Domains Protein: ENSMUSP00000030879
Gene: ENSMUSG00000029016
AA Change: S7P

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:Voltage_CLC 138 571 5.5e-98 PFAM
CBS 609 658 1.68e-3 SMART
CBS 811 859 1.34e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069604
SMART Domains Protein: ENSMUSP00000069774
Gene: ENSMUSG00000029009

DomainStartEndE-ValueType
low complexity region 48 73 N/A INTRINSIC
Pfam:MTHFR 88 377 2.3e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097788
SMART Domains Protein: ENSMUSP00000095395
Gene: ENSMUSG00000029009

DomainStartEndE-ValueType
low complexity region 7 32 N/A INTRINSIC
Pfam:MTHFR 47 336 5.9e-121 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000105711
AA Change: S7P
SMART Domains Protein: ENSMUSP00000101336
Gene: ENSMUSG00000029016
AA Change: S7P

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:Voltage_CLC 141 574 1.5e-98 PFAM
CBS 612 661 1.68e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125978
Predicted Effect probably benign
Transcript: ENSMUST00000131232
SMART Domains Protein: ENSMUSP00000116153
Gene: ENSMUSG00000029016

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000137724
AA Change: S7P
SMART Domains Protein: ENSMUSP00000121751
Gene: ENSMUSG00000029016
AA Change: S7P

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:Voltage_CLC 141 574 1.9e-101 PFAM
CBS 612 661 1.68e-3 SMART
CBS 814 862 1.34e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145115
Predicted Effect probably benign
Transcript: ENSMUST00000152498
SMART Domains Protein: ENSMUSP00000117095
Gene: ENSMUSG00000029009

DomainStartEndE-ValueType
low complexity region 23 48 N/A INTRINSIC
Pfam:MTHFR 63 352 2.4e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141283
SMART Domains Protein: ENSMUSP00000116239
Gene: ENSMUSG00000029009

DomainStartEndE-ValueType
low complexity region 7 32 N/A INTRINSIC
Pfam:MTHFR 47 194 7.4e-57 PFAM
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.5%
  • 20x: 94.4%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: This gene encodes a member of the ClC chloride channel and transporter family of proteins. The encoded protein may function as a vesicular Cl-/H+ antiporter. Homozygous knockout mice exhibit decreased pain sensitivity, behavioral abnormalities and features of lysosomal storage disease. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired nociception, mild behavioral abnormalities, and a progressive neuropathy of the central and peripheral nervous systems with features of neuronal ceroid lipofuscinosis (a lysosomal storage disease). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,092,860 (GRCm39) V308E probably benign Het
Amy1 A G 3: 113,356,418 (GRCm39) probably benign Het
Astn2 C T 4: 66,103,379 (GRCm39) V345M unknown Het
Brwd1 T C 16: 95,844,286 (GRCm39) E756G probably damaging Het
Ccpg1 C T 9: 72,909,103 (GRCm39) L135F probably benign Het
Cecr2 C T 6: 120,734,845 (GRCm39) H694Y probably damaging Het
Cfh G A 1: 140,110,920 (GRCm39) T14I probably damaging Het
Cfhr2 G A 1: 139,741,172 (GRCm39) R268* probably null Het
Clca3a1 T A 3: 144,738,350 (GRCm39) I53L probably benign Het
Cnfn C T 7: 25,067,256 (GRCm39) V98I probably benign Het
Cntnap1 C T 11: 101,077,840 (GRCm39) R1122W probably damaging Het
Cpne9 A T 6: 113,272,024 (GRCm39) E384V probably damaging Het
Ctr9 T C 7: 110,648,705 (GRCm39) probably benign Het
Ctsj T A 13: 61,151,515 (GRCm39) probably benign Het
Cyp2c39 A C 19: 39,501,934 (GRCm39) probably benign Het
Dock5 A C 14: 68,046,481 (GRCm39) I767S probably damaging Het
Eftud2 T C 11: 102,737,446 (GRCm39) T552A probably damaging Het
Epdr1 A G 13: 19,778,715 (GRCm39) I25T probably damaging Het
Fcgbp A T 7: 27,789,138 (GRCm39) D568V probably damaging Het
Fcgbpl1 T A 7: 27,836,516 (GRCm39) V145D probably damaging Het
Fhip1b T C 7: 105,038,654 (GRCm39) E195G probably damaging Het
Frem2 T A 3: 53,555,342 (GRCm39) T1732S probably damaging Het
Fuz T C 7: 44,547,982 (GRCm39) V183A possibly damaging Het
Grb7 T C 11: 98,344,046 (GRCm39) S284P probably damaging Het
Hoxb4 G T 11: 96,209,713 (GRCm39) G40C probably damaging Het
Kcnn1 T C 8: 71,316,513 (GRCm39) probably benign Het
Kmt2d C A 15: 98,733,088 (GRCm39) probably benign Het
L3mbtl3 A G 10: 26,203,732 (GRCm39) V366A unknown Het
Ldlr G A 9: 21,651,040 (GRCm39) R486H probably benign Het
Lnpep A T 17: 17,795,658 (GRCm39) probably benign Het
Mical3 A T 6: 121,006,602 (GRCm39) probably benign Het
Myh15 T C 16: 48,992,250 (GRCm39) probably benign Het
Nup155 T A 15: 8,159,716 (GRCm39) H542Q probably benign Het
Opn4 A G 14: 34,320,930 (GRCm39) probably benign Het
Or13a20 T C 7: 140,231,976 (GRCm39) F28S probably benign Het
Or4a68 T A 2: 89,269,698 (GRCm39) R308S possibly damaging Het
Or6c68 A G 10: 129,157,916 (GRCm39) I141M probably benign Het
Or8g4 A T 9: 39,662,414 (GRCm39) H244L probably damaging Het
Or8h10 T C 2: 86,809,126 (GRCm39) N5D probably damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 142,526,889 (GRCm39) probably benign Het
Parp14 T C 16: 35,661,382 (GRCm39) K1522R probably benign Het
Pkhd1 A T 1: 20,594,335 (GRCm39) D1259E probably benign Het
Pogz C T 3: 94,786,664 (GRCm39) A1084V probably damaging Het
Popdc3 G A 10: 45,191,359 (GRCm39) V157M probably benign Het
Prrt4 T C 6: 29,171,183 (GRCm39) Y423C probably damaging Het
Qrich1 C T 9: 108,411,719 (GRCm39) H415Y probably damaging Het
Rabgap1 A G 2: 37,433,235 (GRCm39) N801D probably benign Het
Rb1 A G 14: 73,525,124 (GRCm39) probably benign Het
Rp1 A T 1: 4,418,060 (GRCm39) N1017K possibly damaging Het
Ryr2 T C 13: 11,650,445 (GRCm39) D356G probably null Het
Skint8 C G 4: 111,794,126 (GRCm39) P172R probably damaging Het
Slc12a8 T G 16: 33,478,600 (GRCm39) M643R possibly damaging Het
Sult1c2 A T 17: 54,271,113 (GRCm39) probably benign Het
Tasor2 A G 13: 3,640,321 (GRCm39) L272P probably damaging Het
Tcaf1 T A 6: 42,650,473 (GRCm39) M869L probably damaging Het
Tecpr1 T C 5: 144,154,219 (GRCm39) N78S probably damaging Het
Tectb A T 19: 55,170,356 (GRCm39) Y69F probably damaging Het
Them4 A T 3: 94,237,101 (GRCm39) N187I possibly damaging Het
Tm9sf3 A G 19: 41,244,582 (GRCm39) probably null Het
Tnik G T 3: 28,631,510 (GRCm39) probably benign Het
Tns2 G T 15: 102,018,020 (GRCm39) probably benign Het
Tnxb A G 17: 34,891,118 (GRCm39) D487G probably damaging Het
Trim33 T A 3: 103,217,660 (GRCm39) C202S probably damaging Het
Trpm2 T A 10: 77,759,350 (GRCm39) I1145F probably damaging Het
Trpv2 A G 11: 62,483,596 (GRCm39) T478A probably benign Het
Ube2e3 T C 2: 78,750,334 (GRCm39) Y187H probably benign Het
Ubxn11 A G 4: 133,836,963 (GRCm39) R64G possibly damaging Het
Wwtr1 T C 3: 57,366,487 (GRCm39) T407A probably damaging Het
Zfyve26 A T 12: 79,315,502 (GRCm39) S1325T possibly damaging Het
Other mutations in Clcn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Clcn6 APN 4 148,102,359 (GRCm39) critical splice donor site probably null
IGL00434:Clcn6 APN 4 148,098,195 (GRCm39) missense probably damaging 1.00
IGL00973:Clcn6 APN 4 148,098,245 (GRCm39) splice site probably benign
IGL01384:Clcn6 APN 4 148,103,423 (GRCm39) missense probably damaging 1.00
IGL01465:Clcn6 APN 4 148,105,908 (GRCm39) splice site probably benign
IGL01522:Clcn6 APN 4 148,101,992 (GRCm39) missense probably benign 0.44
R0194:Clcn6 UTSW 4 148,097,213 (GRCm39) missense probably damaging 1.00
R0280:Clcn6 UTSW 4 148,093,172 (GRCm39) missense probably damaging 1.00
R0349:Clcn6 UTSW 4 148,108,651 (GRCm39) missense possibly damaging 0.89
R0352:Clcn6 UTSW 4 148,099,063 (GRCm39) missense probably damaging 1.00
R0927:Clcn6 UTSW 4 148,113,849 (GRCm39) missense probably benign 0.30
R1141:Clcn6 UTSW 4 148,098,356 (GRCm39) missense probably damaging 0.99
R1465:Clcn6 UTSW 4 148,098,358 (GRCm39) missense probably damaging 1.00
R1465:Clcn6 UTSW 4 148,098,358 (GRCm39) missense probably damaging 1.00
R1473:Clcn6 UTSW 4 148,108,613 (GRCm39) missense possibly damaging 0.93
R1551:Clcn6 UTSW 4 148,097,235 (GRCm39) missense possibly damaging 0.74
R1571:Clcn6 UTSW 4 148,097,226 (GRCm39) missense possibly damaging 0.63
R1593:Clcn6 UTSW 4 148,099,051 (GRCm39) missense probably benign
R1596:Clcn6 UTSW 4 148,107,836 (GRCm39) missense probably damaging 1.00
R1706:Clcn6 UTSW 4 148,102,025 (GRCm39) missense probably benign 0.00
R1769:Clcn6 UTSW 4 148,098,758 (GRCm39) splice site probably null
R2021:Clcn6 UTSW 4 148,095,109 (GRCm39) critical splice donor site probably null
R2022:Clcn6 UTSW 4 148,095,109 (GRCm39) critical splice donor site probably null
R2049:Clcn6 UTSW 4 148,108,594 (GRCm39) missense possibly damaging 0.88
R2081:Clcn6 UTSW 4 148,095,525 (GRCm39) missense probably damaging 1.00
R2140:Clcn6 UTSW 4 148,108,594 (GRCm39) missense possibly damaging 0.88
R2141:Clcn6 UTSW 4 148,108,594 (GRCm39) missense possibly damaging 0.88
R2142:Clcn6 UTSW 4 148,108,594 (GRCm39) missense possibly damaging 0.88
R2177:Clcn6 UTSW 4 148,099,057 (GRCm39) missense possibly damaging 0.73
R2511:Clcn6 UTSW 4 148,101,951 (GRCm39) critical splice donor site probably null
R2891:Clcn6 UTSW 4 148,097,073 (GRCm39) critical splice donor site probably null
R3750:Clcn6 UTSW 4 148,108,644 (GRCm39) nonsense probably null
R4014:Clcn6 UTSW 4 148,102,067 (GRCm39) missense probably damaging 0.98
R4023:Clcn6 UTSW 4 148,098,740 (GRCm39) missense possibly damaging 0.91
R4024:Clcn6 UTSW 4 148,098,740 (GRCm39) missense possibly damaging 0.91
R4025:Clcn6 UTSW 4 148,098,740 (GRCm39) missense possibly damaging 0.91
R4667:Clcn6 UTSW 4 148,108,624 (GRCm39) missense possibly damaging 0.61
R4865:Clcn6 UTSW 4 148,104,223 (GRCm39) missense probably damaging 1.00
R4978:Clcn6 UTSW 4 148,093,227 (GRCm39) missense probably benign 0.05
R5140:Clcn6 UTSW 4 148,122,774 (GRCm39) unclassified probably benign
R5345:Clcn6 UTSW 4 148,123,206 (GRCm39) unclassified probably benign
R5467:Clcn6 UTSW 4 148,102,093 (GRCm39) missense possibly damaging 0.81
R5665:Clcn6 UTSW 4 148,099,018 (GRCm39) missense possibly damaging 0.71
R5739:Clcn6 UTSW 4 148,098,646 (GRCm39) missense probably damaging 1.00
R5899:Clcn6 UTSW 4 148,102,049 (GRCm39) missense probably benign 0.01
R6043:Clcn6 UTSW 4 148,093,245 (GRCm39) missense probably damaging 1.00
R6351:Clcn6 UTSW 4 148,101,957 (GRCm39) missense probably benign 0.01
R6593:Clcn6 UTSW 4 148,095,226 (GRCm39) missense probably benign 0.21
R7440:Clcn6 UTSW 4 148,098,652 (GRCm39) missense probably damaging 1.00
R7674:Clcn6 UTSW 4 148,097,151 (GRCm39) missense probably damaging 1.00
R7756:Clcn6 UTSW 4 148,113,896 (GRCm39) missense probably damaging 1.00
R7901:Clcn6 UTSW 4 148,095,202 (GRCm39) missense probably damaging 1.00
R8559:Clcn6 UTSW 4 148,111,032 (GRCm39) missense possibly damaging 0.88
R8747:Clcn6 UTSW 4 148,093,354 (GRCm39) critical splice donor site probably null
R9246:Clcn6 UTSW 4 148,113,866 (GRCm39) missense probably benign 0.25
R9343:Clcn6 UTSW 4 148,098,458 (GRCm39) missense probably benign 0.03
V7732:Clcn6 UTSW 4 148,098,412 (GRCm39) missense probably damaging 0.96
Z1177:Clcn6 UTSW 4 148,107,827 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCATTAATTCAAGCTGGCCGAGG -3'
(R):5'- CTGTCGGTTGCTAAGGGAAACAGG -3'

Sequencing Primer
(F):5'- AGGTAAGCTGGATGCTTCCC -3'
(R):5'- GGCGGAAGCCACATCTAC -3'
Posted On 2013-07-11