Mutagenetix > Incidental Mutations

Incidental Mutation 'R7159:Lrp6'

557500

Institutional Source

Beutler Lab

Gene Symbol

Lrp6

Ensembl Gene

ENSMUSG00000030201

Gene Name

low density lipoprotein receptor-related protein 6

Synonyms

skax26, Cd, ska26, ska

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.964) question?

Stock #

R7159 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

134446476-134566965 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 134507551 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 370 (V370L)

Ref Sequence

ENSEMBL: ENSMUSP00000032322 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032322] [ENSMUST00000126836]

Predicted Effect

probably benign
Transcript: ENSMUST00000032322
AA Change: V370L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000032322
Gene: ENSMUSG00000030201
AA Change: V370L

Domain	Start	End	E-Value	Type
LY	43	85	1.55e-2	SMART
LY	87	129	1.91e-11	SMART
LY	130	173	5.19e-13	SMART
LY	174	216	1.39e-13	SMART
LY	217	258	2.87e-6	SMART
EGF	285	324	2.16e-1	SMART
low complexity region	330	341	N/A	INTRINSIC
LY	352	394	1.29e-8	SMART
LY	395	437	5.73e-15	SMART
LY	438	481	1.07e-14	SMART
LY	482	524	3.07e-15	SMART
LY	525	565	4.66e-6	SMART
EGF	591	628	1.47e-3	SMART
LY	654	696	2.06e-7	SMART
LY	697	739	3.73e-14	SMART
LY	740	783	3.37e-12	SMART
LY	784	825	1.17e-6	SMART
LY	827	865	1.91e-2	SMART
EGF	892	930	7.35e-4	SMART
LY	957	999	1.41e-5	SMART
LY	1005	1048	5.32e-1	SMART
LY	1049	1093	5e-6	SMART
LY	1094	1136	4.25e-9	SMART
LY	1137	1177	1.91e-2	SMART
EGF	1206	1250	1.23e1	SMART
LDLa	1248	1287	2.42e-12	SMART
LDLa	1288	1324	4.37e-10	SMART
LDLa	1325	1362	1.66e-10	SMART
transmembrane domain	1371	1393	N/A	INTRINSIC
low complexity region	1429	1438	N/A	INTRINSIC
low complexity region	1444	1457	N/A	INTRINSIC
low complexity region	1508	1524	N/A	INTRINSIC
low complexity region	1566	1573	N/A	INTRINSIC
low complexity region	1596	1608	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000126836

SMART Domains

Protein: ENSMUSP00000144733
Gene: ENSMUSG00000030201

Domain	Start	End	E-Value	Type
LY	23	65	6.8e-16	SMART
LY	66	107	1.4e-8	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

99% (70/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.[provided by RefSeq, Dec 2009]
PHENOTYPE: Animals homozygous for this mutation exhibit partial embryonic lethality, growth retardation, crooked tail, abnormal vertebrae, small skull with occasional bent nose, absence of the third molars and small and/or unerupted lower incisors. Heterozygotes exhibit a crooked tail and abnormal vertebrae. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap13	T	A	7: 75,730,579	V500E	possibly damaging	Het
Ankrd34b	T	C	13: 92,439,462	S401P	probably benign	Het
Arfgef2	T	A	2: 166,826,928	D41E	probably benign	Het
Arid1a	T	C	4: 133,753,568	N15S	unknown	Het
Arsa	A	T	15: 89,474,718		probably null	Het
B3gnt9	C	A	8: 105,254,432	C108F	probably damaging	Het
Bbc3	C	A	7: 16,313,808	Y152*	probably null	Het
Btbd1	T	C	7: 81,818,209	M188V	probably benign	Het
Caln1	C	T	5: 130,822,997	T209I	probably benign	Het
Casp12	C	T	9: 5,353,763	P266S	possibly damaging	Het
Ccm2l	A	T	2: 153,070,867	I109F	probably damaging	Het
Chst15	A	C	7: 132,270,258	L98R	probably damaging	Het
Ctsq	A	G	13: 61,038,923	M89T	probably benign	Het
Ddx39b	T	C	17: 35,247,010	V169A	probably benign	Het
Ddx58	A	G	4: 40,213,804	V618A	probably benign	Het
Fam57b	T	C	7: 126,827,495	F80S	probably damaging	Het
Fhad1	T	C	4: 141,951,616	H583R	probably benign	Het
Fndc1	T	A	17: 7,800,931	I139F	probably damaging	Het
Gm5724	T	A	6: 141,773,778	M1L	probably damaging	Het
Gm7145	C	G	1: 117,985,831	H148D	probably benign	Het
Gpr62	C	A	9: 106,465,442	A96S	probably damaging	Het
Gsap	T	A	5: 21,270,620		probably null	Het
Hdhd5	T	A	6: 120,523,471	T89S	probably damaging	Het
Kcna5	T	A	6: 126,533,629	Y512F	probably damaging	Het
Krt84	C	A	15: 101,529,609	E304*	probably null	Het
Krt9	TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC	TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC	11: 100,189,077		probably benign	Het
Lrrc3c	G	A	11: 98,599,318	G167D	probably damaging	Het
Man2b1	C	T	8: 85,087,280	T291M	probably benign	Het
Mapkbp1	A	G	2: 120,025,132	E1438G	possibly damaging	Het
Med12l	A	G	3: 59,276,017	T1947A	probably benign	Het
Myh15	A	T	16: 49,061,574	T60S	probably damaging	Het
Myo5a	A	T	9: 75,171,563	I868F	probably benign	Het
Myom3	A	T	4: 135,808,851	I1278F	probably damaging	Het
Nbn	G	T	4: 15,983,677		probably null	Het
Ncam2	G	T	16: 81,490,374	S392I	probably damaging	Het
Nrg3	A	C	14: 38,370,735	L647*	probably null	Het
Olfr1062	T	A	2: 86,423,612		probably null	Het
Olfr1393	A	T	11: 49,280,358	D70V	probably damaging	Het
Olfr1406	A	T	1: 173,184,323	L37Q	possibly damaging	Het
Olfr721-ps1	T	C	14: 14,407,251	S8P	possibly damaging	Het
Pcdhb9	A	G	18: 37,401,492	N180D	possibly damaging	Het
Pcdhga4	A	G	18: 37,686,919	N507S	probably damaging	Het
Pdilt	A	G	7: 119,487,951	V492A	probably benign	Het
Phf12	A	G	11: 78,023,540	T603A	possibly damaging	Het
Phox2b	T	A	5: 67,097,585	I174F	probably benign	Het
Polq	A	T	16: 37,062,853	Q1793L	possibly damaging	Het
Prmt9	T	C	8: 77,555,764	F97L	probably benign	Het
Prpsap1	T	C	11: 116,494,044	E13G	probably benign	Het
Ptpru	A	G	4: 131,819,540	L280P	probably damaging	Het
Pygl	A	T	12: 70,197,406	M587K	probably benign	Het
Rc3h2	T	C	2: 37,409,647	S124G	probably benign	Het
Rdh5	A	G	10: 128,918,315	I83T	possibly damaging	Het
Ryr2	T	G	13: 11,810,908	R561S	probably damaging	Het
Scara3	A	G	14: 65,920,780	L593P	probably damaging	Het
Scfd2	T	C	5: 74,531,343	I93V	probably benign	Het
Sema4f	C	A	6: 82,917,883	V444L	possibly damaging	Het
Spata33	T	C	8: 123,214,395	L61P	unknown	Het
Stard10	A	T	7: 101,343,136		probably null	Het
Stub1	T	C	17: 25,832,064	I115V	probably benign	Het
Tmem247	C	T	17: 86,918,282	T50I	probably benign	Het
Tnrc6b	A	G	15: 80,887,022	M1103V	possibly damaging	Het
Trim61	T	C	8: 65,013,874	Y245C	probably benign	Het
Trip13	T	C	13: 73,920,011	I284V	probably benign	Het
Trpm4	T	C	7: 45,327,268		probably null	Het
Ttn	A	G	2: 76,730,574	L29161S	probably damaging	Het
Ttn	C	A	2: 76,909,748	L3528F	unknown	Het
Ube2v2	G	A	16: 15,581,084	T47I	probably benign	Het
Vwa5b1	C	T	4: 138,575,422	A921T	possibly damaging	Het
Xylt1	T	A	7: 117,637,602	F526Y	probably damaging	Het

Other mutations in Lrp6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Lrp6	APN	6	134456090	missense	probably benign	0.17
IGL00765:Lrp6	APN	6	134541854	missense	probably benign	0.02
IGL00898:Lrp6	APN	6	134479739	missense	probably damaging	0.99
IGL00916:Lrp6	APN	6	134484289	missense	probably damaging	1.00
IGL00961:Lrp6	APN	6	134507646	missense	probably damaging	0.98
IGL01620:Lrp6	APN	6	134511262	missense	probably damaging	1.00
IGL01765:Lrp6	APN	6	134456145	missense	probably damaging	0.99
IGL02066:Lrp6	APN	6	134450937	nonsense	probably null
IGL02067:Lrp6	APN	6	134480396	missense	probably damaging	0.99
IGL02169:Lrp6	APN	6	134513327	missense	probably damaging	0.96
IGL02281:Lrp6	APN	6	134457734	missense	probably benign	0.40
IGL02484:Lrp6	APN	6	134541923	missense	probably benign	0.15
IGL02724:Lrp6	APN	6	134484265	missense	probably damaging	1.00
IGL02876:Lrp6	APN	6	134456114	missense	probably benign	0.43
IGL03011:Lrp6	APN	6	134520417	missense	possibly damaging	0.80
IGL03352:Lrp6	APN	6	134479763	missense	probably damaging	1.00
Coiled	UTSW	6	134507558	nonsense	probably null
BB004:Lrp6	UTSW	6	134520550	missense	probably damaging	1.00
BB014:Lrp6	UTSW	6	134520550	missense	probably damaging	1.00
PIT4494001:Lrp6	UTSW	6	134479778	missense	probably damaging	1.00
R0008:Lrp6	UTSW	6	134485753	missense	probably damaging	0.96
R0008:Lrp6	UTSW	6	134485753	missense	probably damaging	0.96
R0201:Lrp6	UTSW	6	134450897	nonsense	probably null
R0295:Lrp6	UTSW	6	134457693	missense	probably benign	0.02
R0370:Lrp6	UTSW	6	134479766	missense	probably damaging	1.00
R0382:Lrp6	UTSW	6	134467668	missense	probably damaging	1.00
R0413:Lrp6	UTSW	6	134507624	missense	probably damaging	0.99
R0468:Lrp6	UTSW	6	134485661	missense	possibly damaging	0.94
R0492:Lrp6	UTSW	6	134480518	missense	possibly damaging	0.58
R0584:Lrp6	UTSW	6	134456076	missense	probably damaging	0.99
R0631:Lrp6	UTSW	6	134479775	missense	possibly damaging	0.95
R0738:Lrp6	UTSW	6	134542045	missense	probably benign	0.13
R0907:Lrp6	UTSW	6	134507525	missense	probably damaging	0.96
R1273:Lrp6	UTSW	6	134467507	critical splice donor site	probably null
R1548:Lrp6	UTSW	6	134459429	missense	possibly damaging	0.89
R1639:Lrp6	UTSW	6	134453566	missense	possibly damaging	0.68
R1650:Lrp6	UTSW	6	134468769	missense	probably benign	0.01
R1696:Lrp6	UTSW	6	134468723	missense	probably damaging	1.00
R1751:Lrp6	UTSW	6	134464568	missense	probably damaging	1.00
R1780:Lrp6	UTSW	6	134464451	missense	probably damaging	0.99
R2013:Lrp6	UTSW	6	134480374	critical splice donor site	probably null
R2015:Lrp6	UTSW	6	134480374	critical splice donor site	probably null
R2165:Lrp6	UTSW	6	134459283	missense	probably damaging	1.00
R2294:Lrp6	UTSW	6	134457742	missense	probably damaging	1.00
R2336:Lrp6	UTSW	6	134507583	missense	probably damaging	0.97
R2964:Lrp6	UTSW	6	134467526	missense	probably damaging	1.00
R3716:Lrp6	UTSW	6	134507447	missense	probably damaging	1.00
R4017:Lrp6	UTSW	6	134520550	missense	probably damaging	1.00
R4370:Lrp6	UTSW	6	134506358	nonsense	probably null
R4521:Lrp6	UTSW	6	134485862	missense	probably damaging	1.00
R4573:Lrp6	UTSW	6	134470730	nonsense	probably null
R4645:Lrp6	UTSW	6	134484250	missense	probably damaging	1.00
R4661:Lrp6	UTSW	6	134511267	missense	probably benign
R4688:Lrp6	UTSW	6	134479743	missense	probably damaging	1.00
R4784:Lrp6	UTSW	6	134479539	missense	probably benign	0.06
R5236:Lrp6	UTSW	6	134511264	missense	probably damaging	1.00
R5506:Lrp6	UTSW	6	134459296	missense	probably benign	0.09
R5508:Lrp6	UTSW	6	134464516	missense	probably benign	0.31
R6001:Lrp6	UTSW	6	134464518	missense	probably benign	0.03
R6319:Lrp6	UTSW	6	134541835	missense	possibly damaging	0.46
R6537:Lrp6	UTSW	6	134480495	missense	probably benign
R6552:Lrp6	UTSW	6	134454729	missense	probably benign	0.17
R6559:Lrp6	UTSW	6	134513254	missense	probably damaging	1.00
R6575:Lrp6	UTSW	6	134541971	missense	possibly damaging	0.80
R6585:Lrp6	UTSW	6	134507558	nonsense	probably null
R6700:Lrp6	UTSW	6	134479560	missense	probably damaging	1.00
R6724:Lrp6	UTSW	6	134486541	missense	possibly damaging	0.94
R7266:Lrp6	UTSW	6	134507401	missense	probably damaging	1.00
R7339:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7341:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7342:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7348:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7359:Lrp6	UTSW	6	134450960	nonsense	probably null
R7366:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7368:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7501:Lrp6	UTSW	6	134486508	missense	probably damaging	1.00
R7548:Lrp6	UTSW	6	134507508	missense	probably damaging	0.97
R7652:Lrp6	UTSW	6	134511245	nonsense	probably null
R7771:Lrp6	UTSW	6	134462616	missense	probably damaging	1.00
R7927:Lrp6	UTSW	6	134520550	missense	probably damaging	1.00
Z1176:Lrp6	UTSW	6	134456157	missense	possibly damaging	0.72
Z1177:Lrp6	UTSW	6	134462541	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATCAAGATCTTCCTCATGGTCCC -3'
(R):5'- AGTGACTAAATTTTGCCTGTGG -3'

Sequencing Primer
(F):5'- AAGATCTTCCTCATGGTCCCATTGAG -3'
(R):5'- CCTGTGGCTTTCCAATGTTTG -3'

Posted On

2019-06-26