Mutagenetix > Incidental Mutations

Incidental Mutation 'R7159:Akap13'

557503

Institutional Source

Beutler Lab

Gene Symbol

Akap13

Ensembl Gene

ENSMUSG00000066406

Gene Name

A kinase (PRKA) anchor protein 13

Synonyms

AKAP-Lbc, 5730522G15Rik, 1700026G02Rik, PROTO-LBC, PROTO-LB, Ht31, 5830460E08Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7159 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

75455534-75754609 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 75730579 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 500 (V500E)

Ref Sequence

ENSEMBL: ENSMUSP00000146401 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166315] [ENSMUST00000207239] [ENSMUST00000207750]

Predicted Effect

probably damaging
Transcript: ENSMUST00000166315
AA Change: V2201E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000129784
Gene: ENSMUSG00000066406
AA Change: V2201E

Domain	Start	End	E-Value	Type
low complexity region	174	184	N/A	INTRINSIC
low complexity region	773	789	N/A	INTRINSIC
low complexity region	896	908	N/A	INTRINSIC
low complexity region	1021	1032	N/A	INTRINSIC
low complexity region	1433	1448	N/A	INTRINSIC
low complexity region	1483	1505	N/A	INTRINSIC
low complexity region	1583	1594	N/A	INTRINSIC
low complexity region	1720	1750	N/A	INTRINSIC
C1	1755	1801	1.95e-4	SMART
low complexity region	1858	1869	N/A	INTRINSIC
RhoGEF	1961	2153	1.28e-61	SMART
PH	2195	2298	2.94e-11	SMART
coiled coil region	2308	2345	N/A	INTRINSIC
low complexity region	2393	2412	N/A	INTRINSIC
low complexity region	2444	2454	N/A	INTRINSIC
coiled coil region	2533	2646	N/A	INTRINSIC
low complexity region	2728	2734	N/A	INTRINSIC
low complexity region	2740	2753	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000207239
AA Change: V500E

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)

Predicted Effect

probably damaging
Transcript: ENSMUST00000207750
AA Change: V2219E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

Meta Mutation Damage Score

0.5714

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

99% (70/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms containing c-terminal dbl oncogene homology (DH) and pleckstrin homology (PH) domains. The DH domain is associated with guanine nucleotide exchange activation for the Rho/Rac family of small GTP binding proteins, resulting in the conversion of the inactive GTPase to the active form capable of transducing signals. The PH domain has multiple functions. Therefore, these isoforms function as scaffolding proteins to coordinate a Rho signaling pathway, function as protein kinase A-anchoring proteins and, in addition, enhance ligand-dependent activity of estrogen receptors alpha and beta. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, arrested heart development, and forebrain hypoplasia. Heterozygous mice exhibit small spleen, impaired lymphocyte response to osmotic stress, decreased response to glucocorticoid, osteoporosis and impared osteogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd34b	T	C	13: 92,439,462	S401P	probably benign	Het
Arfgef2	T	A	2: 166,826,928	D41E	probably benign	Het
Arid1a	T	C	4: 133,753,568	N15S	unknown	Het
Arsa	A	T	15: 89,474,718		probably null	Het
B3gnt9	C	A	8: 105,254,432	C108F	probably damaging	Het
Bbc3	C	A	7: 16,313,808	Y152*	probably null	Het
Btbd1	T	C	7: 81,818,209	M188V	probably benign	Het
Caln1	C	T	5: 130,822,997	T209I	probably benign	Het
Casp12	C	T	9: 5,353,763	P266S	possibly damaging	Het
Ccm2l	A	T	2: 153,070,867	I109F	probably damaging	Het
Chst15	A	C	7: 132,270,258	L98R	probably damaging	Het
Ctsq	A	G	13: 61,038,923	M89T	probably benign	Het
Ddx39b	T	C	17: 35,247,010	V169A	probably benign	Het
Ddx58	A	G	4: 40,213,804	V618A	probably benign	Het
Fam57b	T	C	7: 126,827,495	F80S	probably damaging	Het
Fhad1	T	C	4: 141,951,616	H583R	probably benign	Het
Fndc1	T	A	17: 7,800,931	I139F	probably damaging	Het
Gm5724	T	A	6: 141,773,778	M1L	probably damaging	Het
Gm7145	C	G	1: 117,985,831	H148D	probably benign	Het
Gpr62	C	A	9: 106,465,442	A96S	probably damaging	Het
Gsap	T	A	5: 21,270,620		probably null	Het
Hdhd5	T	A	6: 120,523,471	T89S	probably damaging	Het
Kcna5	T	A	6: 126,533,629	Y512F	probably damaging	Het
Krt84	C	A	15: 101,529,609	E304*	probably null	Het
Krt9	TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC	TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC	11: 100,189,077		probably benign	Het
Lrp6	C	A	6: 134,507,551	V370L	probably benign	Het
Lrrc3c	G	A	11: 98,599,318	G167D	probably damaging	Het
Man2b1	C	T	8: 85,087,280	T291M	probably benign	Het
Mapkbp1	A	G	2: 120,025,132	E1438G	possibly damaging	Het
Med12l	A	G	3: 59,276,017	T1947A	probably benign	Het
Myh15	A	T	16: 49,061,574	T60S	probably damaging	Het
Myo5a	A	T	9: 75,171,563	I868F	probably benign	Het
Myom3	A	T	4: 135,808,851	I1278F	probably damaging	Het
Nbn	G	T	4: 15,983,677		probably null	Het
Ncam2	G	T	16: 81,490,374	S392I	probably damaging	Het
Nrg3	A	C	14: 38,370,735	L647*	probably null	Het
Olfr1062	T	A	2: 86,423,612		probably null	Het
Olfr1393	A	T	11: 49,280,358	D70V	probably damaging	Het
Olfr1406	A	T	1: 173,184,323	L37Q	possibly damaging	Het
Olfr721-ps1	T	C	14: 14,407,251	S8P	possibly damaging	Het
Pcdhb9	A	G	18: 37,401,492	N180D	possibly damaging	Het
Pcdhga4	A	G	18: 37,686,919	N507S	probably damaging	Het
Pdilt	A	G	7: 119,487,951	V492A	probably benign	Het
Phf12	A	G	11: 78,023,540	T603A	possibly damaging	Het
Phox2b	T	A	5: 67,097,585	I174F	probably benign	Het
Polq	A	T	16: 37,062,853	Q1793L	possibly damaging	Het
Prmt9	T	C	8: 77,555,764	F97L	probably benign	Het
Prpsap1	T	C	11: 116,494,044	E13G	probably benign	Het
Ptpru	A	G	4: 131,819,540	L280P	probably damaging	Het
Pygl	A	T	12: 70,197,406	M587K	probably benign	Het
Rc3h2	T	C	2: 37,409,647	S124G	probably benign	Het
Rdh5	A	G	10: 128,918,315	I83T	possibly damaging	Het
Ryr2	T	G	13: 11,810,908	R561S	probably damaging	Het
Scara3	A	G	14: 65,920,780	L593P	probably damaging	Het
Scfd2	T	C	5: 74,531,343	I93V	probably benign	Het
Sema4f	C	A	6: 82,917,883	V444L	possibly damaging	Het
Spata33	T	C	8: 123,214,395	L61P	unknown	Het
Stard10	A	T	7: 101,343,136		probably null	Het
Stub1	T	C	17: 25,832,064	I115V	probably benign	Het
Tmem247	C	T	17: 86,918,282	T50I	probably benign	Het
Tnrc6b	A	G	15: 80,887,022	M1103V	possibly damaging	Het
Trim61	T	C	8: 65,013,874	Y245C	probably benign	Het
Trip13	T	C	13: 73,920,011	I284V	probably benign	Het
Trpm4	T	C	7: 45,327,268		probably null	Het
Ttn	A	G	2: 76,730,574	L29161S	probably damaging	Het
Ttn	C	A	2: 76,909,748	L3528F	unknown	Het
Ube2v2	G	A	16: 15,581,084	T47I	probably benign	Het
Vwa5b1	C	T	4: 138,575,422	A921T	possibly damaging	Het
Xylt1	T	A	7: 117,637,602	F526Y	probably damaging	Het

Other mutations in Akap13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Akap13	APN	7	75725971	missense	probably damaging	0.99
IGL00332:Akap13	APN	7	75728919	missense	probably damaging	1.00
IGL00481:Akap13	APN	7	75723895	missense	probably damaging	1.00
IGL00590:Akap13	APN	7	75610669	missense	probably benign	0.01
IGL00655:Akap13	APN	7	75704398	missense	probably damaging	0.99
IGL00766:Akap13	APN	7	75704512	missense	probably damaging	0.96
IGL00818:Akap13	APN	7	75609727	missense	probably benign	0.00
IGL00826:Akap13	APN	7	75677447	missense	probably damaging	1.00
IGL01014:Akap13	APN	7	75750633	utr 3 prime	probably benign
IGL01090:Akap13	APN	7	75666531	missense	probably benign	0.44
IGL01155:Akap13	APN	7	75569936	missense	probably damaging	1.00
IGL01326:Akap13	APN	7	75725348	missense	probably benign	0.30
IGL01456:Akap13	APN	7	75602847	missense	probably damaging	0.98
IGL01460:Akap13	APN	7	75747846	missense	probably benign	0.29
IGL01568:Akap13	APN	7	75608522	nonsense	probably null	0.00
IGL01610:Akap13	APN	7	75720180	missense	possibly damaging	0.71
IGL01610:Akap13	APN	7	75747605	missense	probably damaging	1.00
IGL01615:Akap13	APN	7	75697393	missense	probably damaging	1.00
IGL01667:Akap13	APN	7	75570019	missense	probably damaging	1.00
IGL01705:Akap13	APN	7	75746767	missense	possibly damaging	0.86
IGL02070:Akap13	APN	7	75666545	missense	probably benign	0.27
IGL02269:Akap13	APN	7	75602911	missense	probably benign
IGL02421:Akap13	APN	7	75717806	missense	possibly damaging	0.66
IGL02870:Akap13	APN	7	75609188	missense	probably damaging	0.96
IGL02944:Akap13	APN	7	75608657	missense	probably benign
IGL03051:Akap13	APN	7	75610485	nonsense	probably null
IGL03160:Akap13	APN	7	75730417	missense	probably damaging	1.00
IGL03245:Akap13	APN	7	75609752	missense	probably damaging	0.99
R0254:Akap13	UTSW	7	75736604	splice site	probably benign
R0310:Akap13	UTSW	7	75614930	missense	probably damaging	0.99
R0373:Akap13	UTSW	7	75609929	missense	probably benign	0.00
R0373:Akap13	UTSW	7	75730500	missense	probably damaging	1.00
R0408:Akap13	UTSW	7	75746796	missense	probably damaging	1.00
R0631:Akap13	UTSW	7	75614996	missense	probably damaging	0.99
R0646:Akap13	UTSW	7	75747746	missense	probably damaging	1.00
R0781:Akap13	UTSW	7	75611377	missense	possibly damaging	0.56
R0845:Akap13	UTSW	7	75725380	missense	probably damaging	1.00
R1004:Akap13	UTSW	7	75687286	missense	probably damaging	0.99
R1024:Akap13	UTSW	7	75677409	missense	probably damaging	1.00
R1110:Akap13	UTSW	7	75611377	missense	possibly damaging	0.56
R1346:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1349:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1372:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1387:Akap13	UTSW	7	75586193	missense	probably damaging	0.97
R1442:Akap13	UTSW	7	75735778	missense	probably damaging	0.99
R1466:Akap13	UTSW	7	75729049	missense	possibly damaging	0.79
R1466:Akap13	UTSW	7	75729049	missense	possibly damaging	0.79
R1584:Akap13	UTSW	7	75729049	missense	possibly damaging	0.79
R1696:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1738:Akap13	UTSW	7	75677194	missense	probably damaging	1.00
R1773:Akap13	UTSW	7	75683451	missense	possibly damaging	0.80
R1785:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R1786:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R1791:Akap13	UTSW	7	75611035	missense	probably benign	0.00
R1819:Akap13	UTSW	7	75608705	missense	probably benign	0.04
R1879:Akap13	UTSW	7	75610727	missense	probably benign	0.01
R1989:Akap13	UTSW	7	75704516	missense	probably benign	0.01
R2016:Akap13	UTSW	7	75704531	missense	probably damaging	0.99
R2092:Akap13	UTSW	7	75610570	missense	probably benign	0.05
R2126:Akap13	UTSW	7	75725304	missense	possibly damaging	0.95
R2131:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R2132:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R2133:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R2251:Akap13	UTSW	7	75739477	missense	possibly damaging	0.50
R3704:Akap13	UTSW	7	75666550	missense	probably damaging	1.00
R3713:Akap13	UTSW	7	75586181	missense	probably damaging	0.98
R3731:Akap13	UTSW	7	75611377	missense	probably benign	0.39
R3765:Akap13	UTSW	7	75608837	missense	probably benign	0.04
R3788:Akap13	UTSW	7	75702153	critical splice donor site	probably null
R3793:Akap13	UTSW	7	75610141	missense	probably benign	0.00
R3970:Akap13	UTSW	7	75569951	nonsense	probably null
R4205:Akap13	UTSW	7	75610919	missense	probably benign	0.05
R4257:Akap13	UTSW	7	75611285	missense	probably damaging	0.98
R4374:Akap13	UTSW	7	75608984	missense	probably damaging	0.96
R4448:Akap13	UTSW	7	75742760	missense	probably damaging	1.00
R4450:Akap13	UTSW	7	75742760	missense	probably damaging	1.00
R4457:Akap13	UTSW	7	75739465	missense	probably damaging	0.99
R4458:Akap13	UTSW	7	75739465	missense	probably damaging	0.99
R4466:Akap13	UTSW	7	75602773	splice site	probably null
R4632:Akap13	UTSW	7	75666553	missense	possibly damaging	0.91
R4667:Akap13	UTSW	7	75729094	missense	probably damaging	1.00
R4669:Akap13	UTSW	7	75729094	missense	probably damaging	1.00
R4671:Akap13	UTSW	7	75579564	nonsense	probably null
R4821:Akap13	UTSW	7	75677507	intron	probably benign
R4868:Akap13	UTSW	7	75743504	missense	probably damaging	1.00
R4894:Akap13	UTSW	7	75725320	missense	possibly damaging	0.76
R4943:Akap13	UTSW	7	75749240	missense	probably benign	0.22
R4962:Akap13	UTSW	7	75749430	missense	probably damaging	0.98
R4988:Akap13	UTSW	7	75730528	missense	probably damaging	1.00
R5119:Akap13	UTSW	7	75687252	missense	probably damaging	0.98
R5141:Akap13	UTSW	7	75609614	missense	probably benign	0.18
R5419:Akap13	UTSW	7	75610243	missense	probably benign	0.01
R5427:Akap13	UTSW	7	75728869	missense	possibly damaging	0.89
R5429:Akap13	UTSW	7	75602904	missense	possibly damaging	0.70
R5432:Akap13	UTSW	7	75602830	missense	probably damaging	1.00
R5458:Akap13	UTSW	7	75586301	missense	probably damaging	1.00
R5636:Akap13	UTSW	7	75704372	missense	probably damaging	0.96
R5643:Akap13	UTSW	7	75702154	critical splice donor site	probably null
R5898:Akap13	UTSW	7	75729146	missense	probably damaging	1.00
R5932:Akap13	UTSW	7	75610184	missense	probably damaging	1.00
R6135:Akap13	UTSW	7	75609908	missense	possibly damaging	0.94
R6137:Akap13	UTSW	7	75677416	missense	probably damaging	1.00
R6182:Akap13	UTSW	7	75586280	missense	probably benign	0.45
R6310:Akap13	UTSW	7	75749193	missense	probably damaging	0.99
R6346:Akap13	UTSW	7	75685254	missense	probably damaging	1.00
R6466:Akap13	UTSW	7	75727044	missense	probably benign	0.01
R6605:Akap13	UTSW	7	75579768	missense	probably damaging	0.98
R6617:Akap13	UTSW	7	75730363	missense	possibly damaging	0.95
R6621:Akap13	UTSW	7	75569981	missense	probably damaging	1.00
R6703:Akap13	UTSW	7	75602898	missense	probably damaging	1.00
R6750:Akap13	UTSW	7	75739458	missense	probably benign	0.03
R7069:Akap13	UTSW	7	75610262	missense	probably benign	0.29
R7116:Akap13	UTSW	7	75720195	missense	probably benign	0.00
R7158:Akap13	UTSW	7	75579594	missense	probably damaging	0.97
R7467:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7468:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7471:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7472:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7477:Akap13	UTSW	7	75749247	missense	probably benign
R7636:Akap13	UTSW	7	75609873	missense	probably benign	0.04
R7650:Akap13	UTSW	7	75643454	missense	probably benign	0.20
R7671:Akap13	UTSW	7	75569900	missense	probably damaging	1.00
R7681:Akap13	UTSW	7	75728796	missense	possibly damaging	0.91
R7752:Akap13	UTSW	7	75677258	missense	possibly damaging	0.74
R7784:Akap13	UTSW	7	75610328	missense	probably benign	0.00
R7816:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7817:Akap13	UTSW	7	75730465	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTCTCCCAAGACAATGAAGTG -3'
(R):5'- ACTGACCTGATCCCACAATGG -3'

Sequencing Primer
(F):5'- GGAAGACCTCACTCAGTCCTTG -3'
(R):5'- TGATCCCACAATGGCCACTCG -3'

Posted On

2019-06-26