Incidental Mutation 'R7159:Pygl'
ID557523
Institutional Source Beutler Lab
Gene Symbol Pygl
Ensembl Gene ENSMUSG00000021069
Gene Nameliver glycogen phosphorylase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.443) question?
Stock #R7159 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location70190811-70231488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70197406 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 587 (M587K)
Ref Sequence ENSEMBL: ENSMUSP00000071231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071250] [ENSMUST00000161083]
Predicted Effect probably benign
Transcript: ENSMUST00000071250
AA Change: M587K

PolyPhen 2 Score 0.409 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000071231
Gene: ENSMUSG00000021069
AA Change: M587K

DomainStartEndE-ValueType
Pfam:Phosphorylase 113 829 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161083
AA Change: M496K

PolyPhen 2 Score 0.409 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125585
Gene: ENSMUSG00000021069
AA Change: M496K

DomainStartEndE-ValueType
Pfam:Phosphorylase 21 739 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homodimeric protein that catalyses the cleavage of alpha-1,4-glucosidic bonds to release glucose-1-phosphate from liver glycogen stores. This protein switches from inactive phosphorylase B to active phosphorylase A by phosphorylation of serine residue 15. Activity of this enzyme is further regulated by multiple allosteric effectors and hormonal controls. Humans have three glycogen phosphorylase genes that encode distinct isozymes that are primarily expressed in liver, brain and muscle, respectively. The liver isozyme serves the glycemic demands of the body in general while the brain and muscle isozymes supply just those tissues. In glycogen storage disease type VI, also known as Hers disease, mutations in liver glycogen phosphorylase inhibit the conversion of glycogen to glucose and results in moderate hypoglycemia, mild ketosis, growth retardation and hepatomegaly. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T A 7: 75,730,579 V500E possibly damaging Het
Ankrd34b T C 13: 92,439,462 S401P probably benign Het
Arfgef2 T A 2: 166,826,928 D41E probably benign Het
Arid1a T C 4: 133,753,568 N15S unknown Het
Arsa A T 15: 89,474,718 probably null Het
B3gnt9 C A 8: 105,254,432 C108F probably damaging Het
Bbc3 C A 7: 16,313,808 Y152* probably null Het
Btbd1 T C 7: 81,818,209 M188V probably benign Het
Caln1 C T 5: 130,822,997 T209I probably benign Het
Casp12 C T 9: 5,353,763 P266S possibly damaging Het
Ccm2l A T 2: 153,070,867 I109F probably damaging Het
Chst15 A C 7: 132,270,258 L98R probably damaging Het
Ctsq A G 13: 61,038,923 M89T probably benign Het
Ddx39b T C 17: 35,247,010 V169A probably benign Het
Ddx58 A G 4: 40,213,804 V618A probably benign Het
Fam57b T C 7: 126,827,495 F80S probably damaging Het
Fhad1 T C 4: 141,951,616 H583R probably benign Het
Fndc1 T A 17: 7,800,931 I139F probably damaging Het
Gm5724 T A 6: 141,773,778 M1L probably damaging Het
Gm7145 C G 1: 117,985,831 H148D probably benign Het
Gpr62 C A 9: 106,465,442 A96S probably damaging Het
Gsap T A 5: 21,270,620 probably null Het
Hdhd5 T A 6: 120,523,471 T89S probably damaging Het
Kcna5 T A 6: 126,533,629 Y512F probably damaging Het
Krt84 C A 15: 101,529,609 E304* probably null Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lrp6 C A 6: 134,507,551 V370L probably benign Het
Lrrc3c G A 11: 98,599,318 G167D probably damaging Het
Man2b1 C T 8: 85,087,280 T291M probably benign Het
Mapkbp1 A G 2: 120,025,132 E1438G possibly damaging Het
Med12l A G 3: 59,276,017 T1947A probably benign Het
Myh15 A T 16: 49,061,574 T60S probably damaging Het
Myo5a A T 9: 75,171,563 I868F probably benign Het
Myom3 A T 4: 135,808,851 I1278F probably damaging Het
Nbn G T 4: 15,983,677 probably null Het
Ncam2 G T 16: 81,490,374 S392I probably damaging Het
Nrg3 A C 14: 38,370,735 L647* probably null Het
Olfr1062 T A 2: 86,423,612 probably null Het
Olfr1393 A T 11: 49,280,358 D70V probably damaging Het
Olfr1406 A T 1: 173,184,323 L37Q possibly damaging Het
Olfr721-ps1 T C 14: 14,407,251 S8P possibly damaging Het
Pcdhb9 A G 18: 37,401,492 N180D possibly damaging Het
Pcdhga4 A G 18: 37,686,919 N507S probably damaging Het
Pdilt A G 7: 119,487,951 V492A probably benign Het
Phf12 A G 11: 78,023,540 T603A possibly damaging Het
Phox2b T A 5: 67,097,585 I174F probably benign Het
Polq A T 16: 37,062,853 Q1793L possibly damaging Het
Prmt9 T C 8: 77,555,764 F97L probably benign Het
Prpsap1 T C 11: 116,494,044 E13G probably benign Het
Ptpru A G 4: 131,819,540 L280P probably damaging Het
Rc3h2 T C 2: 37,409,647 S124G probably benign Het
Rdh5 A G 10: 128,918,315 I83T possibly damaging Het
Ryr2 T G 13: 11,810,908 R561S probably damaging Het
Scara3 A G 14: 65,920,780 L593P probably damaging Het
Scfd2 T C 5: 74,531,343 I93V probably benign Het
Sema4f C A 6: 82,917,883 V444L possibly damaging Het
Spata33 T C 8: 123,214,395 L61P unknown Het
Stard10 A T 7: 101,343,136 probably null Het
Stub1 T C 17: 25,832,064 I115V probably benign Het
Tmem247 C T 17: 86,918,282 T50I probably benign Het
Tnrc6b A G 15: 80,887,022 M1103V possibly damaging Het
Trim61 T C 8: 65,013,874 Y245C probably benign Het
Trip13 T C 13: 73,920,011 I284V probably benign Het
Trpm4 T C 7: 45,327,268 probably null Het
Ttn A G 2: 76,730,574 L29161S probably damaging Het
Ttn C A 2: 76,909,748 L3528F unknown Het
Ube2v2 G A 16: 15,581,084 T47I probably benign Het
Vwa5b1 C T 4: 138,575,422 A921T possibly damaging Het
Xylt1 T A 7: 117,637,602 F526Y probably damaging Het
Other mutations in Pygl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Pygl APN 12 70191092 missense probably damaging 1.00
IGL00903:Pygl APN 12 70207742 missense probably damaging 1.00
IGL01965:Pygl APN 12 70191114 missense probably benign 0.00
IGL02347:Pygl APN 12 70201892 missense probably benign 0.14
IGL02403:Pygl APN 12 70194258 missense probably benign
IGL02501:Pygl APN 12 70191134 missense probably benign 0.05
IGL02727:Pygl APN 12 70207668 splice site probably null
IGL03125:Pygl APN 12 70197482 missense probably damaging 1.00
IGL03158:Pygl APN 12 70195675 missense probably damaging 1.00
IGL03202:Pygl APN 12 70199646 missense probably benign
IGL03368:Pygl APN 12 70191152 missense probably benign
R0096:Pygl UTSW 12 70191166 splice site probably benign
R0096:Pygl UTSW 12 70191166 splice site probably benign
R0524:Pygl UTSW 12 70207724 missense probably damaging 1.00
R0883:Pygl UTSW 12 70206404 missense probably damaging 0.97
R0894:Pygl UTSW 12 70194374 splice site probably benign
R0905:Pygl UTSW 12 70211017 splice site probably benign
R1494:Pygl UTSW 12 70199730 missense probably damaging 0.98
R1621:Pygl UTSW 12 70191092 missense probably damaging 1.00
R1647:Pygl UTSW 12 70197010 missense possibly damaging 0.60
R3082:Pygl UTSW 12 70197529 missense probably damaging 1.00
R3845:Pygl UTSW 12 70198443 missense probably benign 0.12
R3876:Pygl UTSW 12 70201339 missense probably damaging 1.00
R4358:Pygl UTSW 12 70195690 missense probably damaging 1.00
R4614:Pygl UTSW 12 70210979 splice site probably null
R4707:Pygl UTSW 12 70207758 missense possibly damaging 0.69
R4908:Pygl UTSW 12 70197033 missense probably null
R4940:Pygl UTSW 12 70206381 missense probably damaging 1.00
R5077:Pygl UTSW 12 70201892 missense probably benign 0.14
R5186:Pygl UTSW 12 70201344 missense probably damaging 1.00
R5726:Pygl UTSW 12 70191142 nonsense probably null
R5953:Pygl UTSW 12 70219627 missense probably damaging 1.00
R5957:Pygl UTSW 12 70199720 missense probably damaging 0.99
R6020:Pygl UTSW 12 70216654 missense probably damaging 1.00
R6024:Pygl UTSW 12 70197067 missense probably benign 0.09
R7050:Pygl UTSW 12 70219622 missense probably damaging 1.00
R7194:Pygl UTSW 12 70194320 missense probably benign
R7283:Pygl UTSW 12 70216568 missense possibly damaging 0.92
R7360:Pygl UTSW 12 70227532 missense probably benign 0.11
R7446:Pygl UTSW 12 70197010 missense probably benign
R7637:Pygl UTSW 12 70197795 splice site probably null
R7886:Pygl UTSW 12 70206356 splice site probably null
R8054:Pygl UTSW 12 70227339 critical splice donor site probably null
Z1176:Pygl UTSW 12 70222874 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ATTATGACTGTCCTTGGCACG -3'
(R):5'- ACCCTGGAGTGGAGGATTTG -3'

Sequencing Primer
(F):5'- GACTGTCCTTGGCACGAAGAATTTC -3'
(R):5'- ATTTGGGCTCCAGCAGACAC -3'
Posted On2019-06-26