Incidental Mutation 'R7159:Fndc1'
ID557537
Institutional Source Beutler Lab
Gene Symbol Fndc1
Ensembl Gene ENSMUSG00000071984
Gene Namefibronectin type III domain containing 1
Synonyms1110027O12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R7159 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location7738569-7827302 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7800931 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 139 (I139F)
Ref Sequence ENSEMBL: ENSMUSP00000126701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097425] [ENSMUST00000167580] [ENSMUST00000169126]
Predicted Effect probably benign
Transcript: ENSMUST00000097425
SMART Domains Protein: ENSMUSP00000095036
Gene: ENSMUSG00000071984

DomainStartEndE-ValueType
Blast:FN3 1 50 6e-25 BLAST
FN3 54 137 7.82e-4 SMART
FN3 156 240 1.48e-4 SMART
FN3 256 340 3.67e-9 SMART
low complexity region 377 388 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 646 676 N/A INTRINSIC
low complexity region 766 777 N/A INTRINSIC
low complexity region 868 884 N/A INTRINSIC
low complexity region 1021 1027 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
low complexity region 1076 1090 N/A INTRINSIC
Blast:FN3 1227 1276 2e-18 BLAST
low complexity region 1277 1354 N/A INTRINSIC
low complexity region 1395 1403 N/A INTRINSIC
low complexity region 1407 1423 N/A INTRINSIC
FN3 1494 1577 4.32e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167580
SMART Domains Protein: ENSMUSP00000130996
Gene: ENSMUSG00000071984

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
FN3 38 121 7.82e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169126
AA Change: I139F

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126701
Gene: ENSMUSG00000071984
AA Change: I139F

DomainStartEndE-ValueType
low complexity region 2 30 N/A INTRINSIC
FN3 37 117 1.22e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (70/71)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T A 7: 75,730,579 V500E possibly damaging Het
Ankrd34b T C 13: 92,439,462 S401P probably benign Het
Arfgef2 T A 2: 166,826,928 D41E probably benign Het
Arid1a T C 4: 133,753,568 N15S unknown Het
Arsa A T 15: 89,474,718 probably null Het
B3gnt9 C A 8: 105,254,432 C108F probably damaging Het
Bbc3 C A 7: 16,313,808 Y152* probably null Het
Btbd1 T C 7: 81,818,209 M188V probably benign Het
Caln1 C T 5: 130,822,997 T209I probably benign Het
Casp12 C T 9: 5,353,763 P266S possibly damaging Het
Ccm2l A T 2: 153,070,867 I109F probably damaging Het
Chst15 A C 7: 132,270,258 L98R probably damaging Het
Ctsq A G 13: 61,038,923 M89T probably benign Het
Ddx39b T C 17: 35,247,010 V169A probably benign Het
Ddx58 A G 4: 40,213,804 V618A probably benign Het
Fam57b T C 7: 126,827,495 F80S probably damaging Het
Fhad1 T C 4: 141,951,616 H583R probably benign Het
Gm5724 T A 6: 141,773,778 M1L probably damaging Het
Gm7145 C G 1: 117,985,831 H148D probably benign Het
Gpr62 C A 9: 106,465,442 A96S probably damaging Het
Gsap T A 5: 21,270,620 probably null Het
Hdhd5 T A 6: 120,523,471 T89S probably damaging Het
Kcna5 T A 6: 126,533,629 Y512F probably damaging Het
Krt84 C A 15: 101,529,609 E304* probably null Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lrp6 C A 6: 134,507,551 V370L probably benign Het
Lrrc3c G A 11: 98,599,318 G167D probably damaging Het
Man2b1 C T 8: 85,087,280 T291M probably benign Het
Mapkbp1 A G 2: 120,025,132 E1438G possibly damaging Het
Med12l A G 3: 59,276,017 T1947A probably benign Het
Myh15 A T 16: 49,061,574 T60S probably damaging Het
Myo5a A T 9: 75,171,563 I868F probably benign Het
Myom3 A T 4: 135,808,851 I1278F probably damaging Het
Nbn G T 4: 15,983,677 probably null Het
Ncam2 G T 16: 81,490,374 S392I probably damaging Het
Nrg3 A C 14: 38,370,735 L647* probably null Het
Olfr1062 T A 2: 86,423,612 probably null Het
Olfr1393 A T 11: 49,280,358 D70V probably damaging Het
Olfr1406 A T 1: 173,184,323 L37Q possibly damaging Het
Olfr721-ps1 T C 14: 14,407,251 S8P possibly damaging Het
Pcdhb9 A G 18: 37,401,492 N180D possibly damaging Het
Pcdhga4 A G 18: 37,686,919 N507S probably damaging Het
Pdilt A G 7: 119,487,951 V492A probably benign Het
Phf12 A G 11: 78,023,540 T603A possibly damaging Het
Phox2b T A 5: 67,097,585 I174F probably benign Het
Polq A T 16: 37,062,853 Q1793L possibly damaging Het
Prmt9 T C 8: 77,555,764 F97L probably benign Het
Prpsap1 T C 11: 116,494,044 E13G probably benign Het
Ptpru A G 4: 131,819,540 L280P probably damaging Het
Pygl A T 12: 70,197,406 M587K probably benign Het
Rc3h2 T C 2: 37,409,647 S124G probably benign Het
Rdh5 A G 10: 128,918,315 I83T possibly damaging Het
Ryr2 T G 13: 11,810,908 R561S probably damaging Het
Scara3 A G 14: 65,920,780 L593P probably damaging Het
Scfd2 T C 5: 74,531,343 I93V probably benign Het
Sema4f C A 6: 82,917,883 V444L possibly damaging Het
Spata33 T C 8: 123,214,395 L61P unknown Het
Stard10 A T 7: 101,343,136 probably null Het
Stub1 T C 17: 25,832,064 I115V probably benign Het
Tmem247 C T 17: 86,918,282 T50I probably benign Het
Tnrc6b A G 15: 80,887,022 M1103V possibly damaging Het
Trim61 T C 8: 65,013,874 Y245C probably benign Het
Trip13 T C 13: 73,920,011 I284V probably benign Het
Trpm4 T C 7: 45,327,268 probably null Het
Ttn A G 2: 76,730,574 L29161S probably damaging Het
Ttn C A 2: 76,909,748 L3528F unknown Het
Ube2v2 G A 16: 15,581,084 T47I probably benign Het
Vwa5b1 C T 4: 138,575,422 A921T possibly damaging Het
Xylt1 T A 7: 117,637,602 F526Y probably damaging Het
Other mutations in Fndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Fndc1 APN 17 7765254 missense unknown
IGL00590:Fndc1 APN 17 7765101 missense unknown
IGL00765:Fndc1 APN 17 7772693 missense unknown
IGL00904:Fndc1 APN 17 7756363 missense probably benign 0.35
IGL01153:Fndc1 APN 17 7780042 critical splice donor site probably null
IGL01557:Fndc1 APN 17 7756389 missense probably damaging 0.99
IGL02493:Fndc1 APN 17 7775545 missense unknown
IGL02501:Fndc1 APN 17 7765398 missense unknown
IGL02503:Fndc1 APN 17 7771516 missense unknown
IGL02887:Fndc1 APN 17 7773638 missense unknown
IGL03348:Fndc1 APN 17 7772647 missense unknown
pinnacle UTSW 17 7773322 missense unknown
spire UTSW 17 7771480 missense unknown
IGL02988:Fndc1 UTSW 17 7753523 missense possibly damaging 0.95
PIT4466001:Fndc1 UTSW 17 7750374 missense probably damaging 1.00
R0336:Fndc1 UTSW 17 7765107 missense unknown
R0403:Fndc1 UTSW 17 7753723 missense probably damaging 1.00
R0403:Fndc1 UTSW 17 7775588 intron probably null
R0538:Fndc1 UTSW 17 7784341 splice site probably benign
R0646:Fndc1 UTSW 17 7741673 missense possibly damaging 0.92
R1140:Fndc1 UTSW 17 7775426 missense unknown
R1523:Fndc1 UTSW 17 7773209 missense unknown
R1609:Fndc1 UTSW 17 7772766 missense unknown
R1632:Fndc1 UTSW 17 7773200 missense unknown
R1888:Fndc1 UTSW 17 7771789 missense unknown
R1888:Fndc1 UTSW 17 7771789 missense unknown
R2004:Fndc1 UTSW 17 7804929 missense probably damaging 1.00
R2007:Fndc1 UTSW 17 7778748 unclassified probably benign
R2128:Fndc1 UTSW 17 7778665 unclassified probably benign
R2187:Fndc1 UTSW 17 7741772 missense probably damaging 1.00
R2251:Fndc1 UTSW 17 7753607 missense probably damaging 1.00
R2322:Fndc1 UTSW 17 7789015 missense probably damaging 0.98
R2425:Fndc1 UTSW 17 7805018 missense probably damaging 1.00
R2921:Fndc1 UTSW 17 7804875 missense probably damaging 0.98
R2985:Fndc1 UTSW 17 7756323 missense possibly damaging 0.93
R3436:Fndc1 UTSW 17 7750357 missense probably damaging 0.99
R3499:Fndc1 UTSW 17 7753584 missense possibly damaging 0.70
R3508:Fndc1 UTSW 17 7765108 nonsense probably null
R3766:Fndc1 UTSW 17 7784421 missense probably damaging 1.00
R3813:Fndc1 UTSW 17 7773322 missense unknown
R3814:Fndc1 UTSW 17 7773322 missense unknown
R4031:Fndc1 UTSW 17 7769752 nonsense probably null
R4544:Fndc1 UTSW 17 7773544 missense unknown
R4583:Fndc1 UTSW 17 7739249 missense probably damaging 1.00
R4619:Fndc1 UTSW 17 7765204 missense unknown
R4700:Fndc1 UTSW 17 7771480 missense unknown
R4743:Fndc1 UTSW 17 7772279 nonsense probably null
R4803:Fndc1 UTSW 17 7753706 missense probably damaging 0.98
R4862:Fndc1 UTSW 17 7769735 missense unknown
R4876:Fndc1 UTSW 17 7771639 missense unknown
R5057:Fndc1 UTSW 17 7771970 nonsense probably null
R5327:Fndc1 UTSW 17 7772708 missense unknown
R5372:Fndc1 UTSW 17 7765210 missense unknown
R5533:Fndc1 UTSW 17 7772776 missense unknown
R5754:Fndc1 UTSW 17 7769753 missense unknown
R5762:Fndc1 UTSW 17 7771534 missense unknown
R5830:Fndc1 UTSW 17 7789086 missense possibly damaging 0.87
R5924:Fndc1 UTSW 17 7773610 missense unknown
R6147:Fndc1 UTSW 17 7753762 splice site probably null
R6175:Fndc1 UTSW 17 7772647 missense unknown
R6303:Fndc1 UTSW 17 7758485 missense probably damaging 0.98
R6377:Fndc1 UTSW 17 7769735 missense unknown
R6704:Fndc1 UTSW 17 7771810 missense unknown
R6857:Fndc1 UTSW 17 7772170 missense unknown
R6865:Fndc1 UTSW 17 7772840 missense unknown
R7069:Fndc1 UTSW 17 7769735 missense unknown
R7153:Fndc1 UTSW 17 7801645 missense probably damaging 1.00
R7359:Fndc1 UTSW 17 7813486 intron probably null
R7731:Fndc1 UTSW 17 7773439 missense unknown
R7743:Fndc1 UTSW 17 7765137 missense unknown
Z1088:Fndc1 UTSW 17 7782479 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AACACAGACGTTGCCCATCG -3'
(R):5'- TTTCAGCACAGCCCAACTAG -3'

Sequencing Primer
(F):5'- CATCAGCTGCAGTCTGACC -3'
(R):5'- CAAGTACAGACCCTACAACTAATTG -3'
Posted On2019-06-26